\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114100604:

Variant ID: vg0114100604 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 14100604
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


AATCTTCTGTGTATGAGTGGTGGCACACGCTCAAAATATTTGTCAGGGATAAATATACTCCCTCCATTTTTAAATATTTGACACCGTTAACTTTTTAGCA[C/T]
ATGTTTGACCGTTCGTCTTATTCAAAAACTTTTGTGAAATATGTAAAACTATACATATACATATAAGTATATTTAACAATGAATTCGAACGGTCAAATAT

Reverse complement sequence

ATATTTGACCGTTCGAATTCATTGTTAAATATACTTATATGTATATGTATAGTTTTACATATTTCACAAAAGTTTTTGAATAAGACGAACGGTCAAACAT[G/A]
TGCTAAAAAGTTAACGGTGTCAAATATTTAAAAATGGAGGGAGTATATTTATCCCTGACAAATATTTTGAGCGTGTGCCACCACTCATACACAGAAGATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.10% 31.30% 0.34% 20.25% NA
All Indica  2759 26.00% 45.80% 0.58% 27.58% NA
All Japonica  1512 95.20% 4.70% 0.00% 0.13% NA
Aus  269 2.20% 31.60% 0.00% 66.17% NA
Indica I  595 2.20% 41.20% 1.01% 55.63% NA
Indica II  465 60.90% 11.80% 0.65% 26.67% NA
Indica III  913 24.80% 68.90% 0.00% 6.35% NA
Indica Intermediate  786 24.80% 42.70% 0.89% 31.55% NA
Temperate Japonica  767 98.30% 1.70% 0.00% 0.00% NA
Tropical Japonica  504 89.10% 10.70% 0.00% 0.20% NA
Japonica Intermediate  241 97.90% 1.70% 0.00% 0.41% NA
VI/Aromatic  96 54.20% 44.80% 0.00% 1.04% NA
Intermediate  90 67.80% 15.60% 0.00% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0114100604 C -> T LOC_Os01g25010.1 upstream_gene_variant ; 1390.0bp to feature; MODIFIER silent_mutation Average:37.178; most accessible tissue: Zhenshan97 flag leaf, score: 54.545 N N N N
vg0114100604 C -> T LOC_Os01g25000.1 downstream_gene_variant ; 1817.0bp to feature; MODIFIER silent_mutation Average:37.178; most accessible tissue: Zhenshan97 flag leaf, score: 54.545 N N N N
vg0114100604 C -> T LOC_Os01g25000-LOC_Os01g25010 intergenic_region ; MODIFIER silent_mutation Average:37.178; most accessible tissue: Zhenshan97 flag leaf, score: 54.545 N N N N
vg0114100604 C -> DEL N N silent_mutation Average:37.178; most accessible tissue: Zhenshan97 flag leaf, score: 54.545 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0114100604 NA 6.59E-08 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114100604 NA 1.52E-06 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114100604 NA 1.22E-06 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114100604 NA 1.46E-06 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114100604 NA 1.97E-09 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114100604 NA 3.79E-08 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114100604 NA 1.41E-07 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114100604 8.14E-07 1.72E-07 mr1193 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114100604 3.02E-06 9.52E-11 mr1193 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114100604 NA 8.92E-06 mr1298 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114100604 NA 7.45E-08 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114100604 NA 8.67E-06 mr1637 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114100604 NA 7.89E-07 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114100604 NA 4.48E-06 mr1677 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114100604 NA 5.09E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114100604 2.16E-06 NA mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114100604 NA 2.41E-12 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251