\
| Variant ID: vg0114041371 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 14041371 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TATACTGATTCAGACTGTCAAGGTGAGGTACTACCCTAGTCTAATTGTACATAGATTGGATCTGTGTGTGCATAATATAGCGTGTGAATAGCACGTAGCA[T/C]
GTATGAAGAAATCGATCAATCACCCCTATTAGGTTTTAGGGGTGACCGGGTAAGGTTGGTAGGTTGTCCCTTATAATCTAGGTACCTACCACCTATTTAC
GTAAATAGGTGGTAGGTACCTAGATTATAAGGGACAACCTACCAACCTTACCCGGTCACCCCTAAAACCTAATAGGGGTGATTGATCGATTTCTTCATAC[A/G]
TGCTACGTGCTATTCACACGCTATATTATGCACACACAGATCCAATCTATGTACAATTAGACTAGGGTAGTACCTCACCTTGACAGTCTGAATCAGTATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.70% | 48.10% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 73.20% | 26.60% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 4.80% | 95.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 45.70% | 53.80% | 0.50% | 0.00% | NA |
| Indica II | 465 | 56.80% | 42.80% | 0.43% | 0.00% | NA |
| Indica III | 913 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 75.10% | 24.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 2.00% | 98.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 10.70% | 89.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 50.00% | 50.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 44.40% | 55.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0114041371 | T -> C | LOC_Os01g24920.1 | downstream_gene_variant ; 2583.0bp to feature; MODIFIER | silent_mutation | Average:61.21; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg0114041371 | T -> C | LOC_Os01g24930.1 | downstream_gene_variant ; 1718.0bp to feature; MODIFIER | silent_mutation | Average:61.21; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg0114041371 | T -> C | LOC_Os01g24920-LOC_Os01g24930 | intergenic_region ; MODIFIER | silent_mutation | Average:61.21; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0114041371 | NA | 5.72E-06 | mr1193 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114041371 | NA | 2.83E-08 | mr1244 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114041371 | NA | 2.86E-09 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114041371 | NA | 4.96E-07 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114041371 | 6.37E-06 | 6.37E-06 | mr1483 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114041371 | NA | 3.16E-08 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114041371 | NA | 6.15E-06 | mr1545 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114041371 | NA | 6.13E-08 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114041371 | NA | 5.13E-06 | mr1586 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114041371 | NA | 2.07E-06 | mr1676 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114041371 | NA | 5.45E-07 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114041371 | NA | 2.48E-10 | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114041371 | NA | 3.95E-12 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114041371 | NA | 1.56E-07 | mr1244_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |