\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114041371:

Variant ID: vg0114041371 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 14041371
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATACTGATTCAGACTGTCAAGGTGAGGTACTACCCTAGTCTAATTGTACATAGATTGGATCTGTGTGTGCATAATATAGCGTGTGAATAGCACGTAGCA[T/C]
GTATGAAGAAATCGATCAATCACCCCTATTAGGTTTTAGGGGTGACCGGGTAAGGTTGGTAGGTTGTCCCTTATAATCTAGGTACCTACCACCTATTTAC

Reverse complement sequence

GTAAATAGGTGGTAGGTACCTAGATTATAAGGGACAACCTACCAACCTTACCCGGTCACCCCTAAAACCTAATAGGGGTGATTGATCGATTTCTTCATAC[A/G]
TGCTACGTGCTATTCACACGCTATATTATGCACACACAGATCCAATCTATGTACAATTAGACTAGGGTAGTACCTCACCTTGACAGTCTGAATCAGTATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.70% 48.10% 0.13% 0.00% NA
All Indica  2759 73.20% 26.60% 0.22% 0.00% NA
All Japonica  1512 4.80% 95.20% 0.00% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 45.70% 53.80% 0.50% 0.00% NA
Indica II  465 56.80% 42.80% 0.43% 0.00% NA
Indica III  913 97.90% 2.10% 0.00% 0.00% NA
Indica Intermediate  786 75.10% 24.80% 0.13% 0.00% NA
Temperate Japonica  767 2.00% 98.00% 0.00% 0.00% NA
Tropical Japonica  504 10.70% 89.30% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 50.00% 50.00% 0.00% 0.00% NA
Intermediate  90 44.40% 55.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0114041371 T -> C LOC_Os01g24920.1 downstream_gene_variant ; 2583.0bp to feature; MODIFIER silent_mutation Average:61.21; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0114041371 T -> C LOC_Os01g24930.1 downstream_gene_variant ; 1718.0bp to feature; MODIFIER silent_mutation Average:61.21; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0114041371 T -> C LOC_Os01g24920-LOC_Os01g24930 intergenic_region ; MODIFIER silent_mutation Average:61.21; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0114041371 NA 5.72E-06 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114041371 NA 2.83E-08 mr1244 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114041371 NA 2.86E-09 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114041371 NA 4.96E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114041371 6.37E-06 6.37E-06 mr1483 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114041371 NA 3.16E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114041371 NA 6.15E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114041371 NA 6.13E-08 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114041371 NA 5.13E-06 mr1586 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114041371 NA 2.07E-06 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114041371 NA 5.45E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114041371 NA 2.48E-10 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114041371 NA 3.95E-12 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114041371 NA 1.56E-07 mr1244_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251