\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113977512:

Variant ID: vg0113977512 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13977512
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.03, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TTTCTAAATTGTATTTCTGTATGGACTCTAGTCTCCTCTTCTAATATTTCTTATTTTTTAATTCCAAATTTCAGCTATTTCTAAATTGTATTTCTATATG[A/G]
ATTCTGTTTTTTCTTTTTCTCCGATTAATGTGAGAATTTCTAGGCCATGAGAGCGAACGTGGAGGCTCATTTTTCTATTCCTTTAATAATATAATAATAG

Reverse complement sequence

CTATTATTATATTATTAAAGGAATAGAAAAATGAGCCTCCACGTTCGCTCTCATGGCCTAGAAATTCTCACATTAATCGGAGAAAAAGAAAAAACAGAAT[T/C]
CATATAGAAATACAATTTAGAAATAGCTGAAATTTGGAATTAAAAAATAAGAAATATTAGAAGAGGAGACTAGAGTCCATACAGAAATACAATTTAGAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.50% 30.10% 0.44% 0.91% NA
All Indica  2759 96.80% 1.10% 0.69% 1.49% NA
All Japonica  1512 11.20% 88.80% 0.00% 0.00% NA
Aus  269 98.90% 0.00% 0.37% 0.74% NA
Indica I  595 97.80% 0.50% 0.67% 1.01% NA
Indica II  465 93.80% 2.20% 0.43% 3.66% NA
Indica III  913 99.00% 0.20% 0.55% 0.22% NA
Indica Intermediate  786 95.20% 1.80% 1.02% 2.04% NA
Temperate Japonica  767 2.10% 97.90% 0.00% 0.00% NA
Tropical Japonica  504 25.20% 74.80% 0.00% 0.00% NA
Japonica Intermediate  241 10.80% 89.20% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 12.50% 1.04% 0.00% NA
Intermediate  90 55.60% 44.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113977512 A -> G LOC_Os01g24810.1 upstream_gene_variant ; 452.0bp to feature; MODIFIER silent_mutation Average:29.333; most accessible tissue: Minghui63 flag leaf, score: 36.591 N N N N
vg0113977512 A -> G LOC_Os01g24820.1 downstream_gene_variant ; 2373.0bp to feature; MODIFIER silent_mutation Average:29.333; most accessible tissue: Minghui63 flag leaf, score: 36.591 N N N N
vg0113977512 A -> G LOC_Os01g24800-LOC_Os01g24810 intergenic_region ; MODIFIER silent_mutation Average:29.333; most accessible tissue: Minghui63 flag leaf, score: 36.591 N N N N
vg0113977512 A -> DEL N N silent_mutation Average:29.333; most accessible tissue: Minghui63 flag leaf, score: 36.591 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113977512 NA 3.71E-10 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0113977512 NA 4.45E-20 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113977512 NA 9.18E-16 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113977512 NA 2.48E-39 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113977512 NA 8.08E-18 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113977512 NA 1.32E-11 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113977512 NA 7.16E-13 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113977512 NA 9.02E-15 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113977512 NA 1.69E-59 mr1711 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113977512 NA 3.88E-18 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113977512 NA 2.46E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113977512 NA 2.35E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113977512 9.16E-06 9.16E-06 mr1065_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113977512 NA 1.74E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113977512 NA 4.15E-06 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113977512 NA 1.26E-14 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113977512 4.91E-06 2.30E-08 mr1200_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113977512 NA 8.54E-111 mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113977512 NA 5.66E-25 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113977512 NA 2.46E-36 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113977512 NA 1.43E-49 mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113977512 NA 1.87E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113977512 NA 7.36E-27 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113977512 NA 9.55E-33 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113977512 NA 1.06E-18 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113977512 NA 3.31E-19 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113977512 NA 5.76E-14 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113977512 NA 5.80E-14 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113977512 NA 1.83E-07 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251