\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113975931:

Variant ID: vg0113975931 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13975931
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCCTTATTTTTAATTCCGCATTTCAGCTATTTTTAAATTGTATTCCTACTTAGACTCTCCTTTCGTTTTCTAATTTTGGATTTTATTTTTTTTATTTC[G/A]
AATTTTAATTAATTATTGGGTTCTTATATAGAAACTTCTTCCAATATTGCTTATTTTTAATTCCGAATTTTAGCTATTTTTAAAATCGTATTTCTACTTG

Reverse complement sequence

CAAGTAGAAATACGATTTTAAAAATAGCTAAAATTCGGAATTAAAAATAAGCAATATTGGAAGAAGTTTCTATATAAGAACCCAATAATTAATTAAAATT[C/T]
GAAATAAAAAAAATAAAATCCAAAATTAGAAAACGAAAGGAGAGTCTAAGTAGGAATACAATTTAAAAATAGCTGAAATGCGGAATTAAAAATAAGGAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.30% 22.00% 6.37% 22.32% NA
All Indica  2759 24.20% 35.30% 9.57% 30.92% NA
All Japonica  1512 99.70% 0.10% 0.07% 0.13% NA
Aus  269 5.60% 15.60% 11.90% 66.91% NA
Indica I  595 16.80% 16.80% 11.60% 54.79% NA
Indica II  465 30.10% 34.00% 6.45% 29.46% NA
Indica III  913 28.30% 49.50% 9.53% 12.71% NA
Indica Intermediate  786 21.60% 33.60% 9.92% 34.86% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.00% 0.20% NA
Japonica Intermediate  241 99.20% 0.00% 0.41% 0.41% NA
VI/Aromatic  96 89.60% 6.20% 3.12% 1.04% NA
Intermediate  90 61.10% 16.70% 1.11% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113975931 G -> A LOC_Os01g24810.1 upstream_gene_variant ; 2033.0bp to feature; MODIFIER silent_mutation Average:14.609; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0113975931 G -> A LOC_Os01g24820.1 downstream_gene_variant ; 3954.0bp to feature; MODIFIER silent_mutation Average:14.609; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0113975931 G -> A LOC_Os01g24800-LOC_Os01g24810 intergenic_region ; MODIFIER silent_mutation Average:14.609; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0113975931 G -> DEL N N silent_mutation Average:14.609; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113975931 NA 2.61E-09 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113975931 NA 1.28E-13 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113975931 NA 1.92E-15 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113975931 NA 6.97E-13 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113975931 NA 4.71E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113975931 NA 1.85E-15 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113975931 NA 2.23E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113975931 NA 7.13E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113975931 NA 4.29E-06 mr1852_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251