\
| Variant ID: vg0113975931 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 13975931 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 105. )
ATTCCTTATTTTTAATTCCGCATTTCAGCTATTTTTAAATTGTATTCCTACTTAGACTCTCCTTTCGTTTTCTAATTTTGGATTTTATTTTTTTTATTTC[G/A]
AATTTTAATTAATTATTGGGTTCTTATATAGAAACTTCTTCCAATATTGCTTATTTTTAATTCCGAATTTTAGCTATTTTTAAAATCGTATTTCTACTTG
CAAGTAGAAATACGATTTTAAAAATAGCTAAAATTCGGAATTAAAAATAAGCAATATTGGAAGAAGTTTCTATATAAGAACCCAATAATTAATTAAAATT[C/T]
GAAATAAAAAAAATAAAATCCAAAATTAGAAAACGAAAGGAGAGTCTAAGTAGGAATACAATTTAAAAATAGCTGAAATGCGGAATTAAAAATAAGGAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.30% | 22.00% | 6.37% | 22.32% | NA |
| All Indica | 2759 | 24.20% | 35.30% | 9.57% | 30.92% | NA |
| All Japonica | 1512 | 99.70% | 0.10% | 0.07% | 0.13% | NA |
| Aus | 269 | 5.60% | 15.60% | 11.90% | 66.91% | NA |
| Indica I | 595 | 16.80% | 16.80% | 11.60% | 54.79% | NA |
| Indica II | 465 | 30.10% | 34.00% | 6.45% | 29.46% | NA |
| Indica III | 913 | 28.30% | 49.50% | 9.53% | 12.71% | NA |
| Indica Intermediate | 786 | 21.60% | 33.60% | 9.92% | 34.86% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.20% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 89.60% | 6.20% | 3.12% | 1.04% | NA |
| Intermediate | 90 | 61.10% | 16.70% | 1.11% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0113975931 | G -> A | LOC_Os01g24810.1 | upstream_gene_variant ; 2033.0bp to feature; MODIFIER | silent_mutation | Average:14.609; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0113975931 | G -> A | LOC_Os01g24820.1 | downstream_gene_variant ; 3954.0bp to feature; MODIFIER | silent_mutation | Average:14.609; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0113975931 | G -> A | LOC_Os01g24800-LOC_Os01g24810 | intergenic_region ; MODIFIER | silent_mutation | Average:14.609; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0113975931 | G -> DEL | N | N | silent_mutation | Average:14.609; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0113975931 | NA | 2.61E-09 | mr1722 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113975931 | NA | 1.28E-13 | mr1874 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113975931 | NA | 1.92E-15 | mr1040_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113975931 | NA | 6.97E-13 | mr1216_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113975931 | NA | 4.71E-07 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113975931 | NA | 1.85E-15 | mr1587_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113975931 | NA | 2.23E-10 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113975931 | NA | 7.13E-07 | mr1654_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113975931 | NA | 4.29E-06 | mr1852_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |