\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113862383:

Variant ID: vg0113862383 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13862383
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


CAAGGACCGAGACAACCTGGCAACGATATCGATGTATTCCTTGAACCGATAATCGCTGACTTCGAAAGGCTATGGAATGAGGGAACACGAACATGGGACG[C/T]
ATATGCACAAGAGTATTTCAACCTCCATGCGATGCTGTTTTGTACCATCAACGATTATCCGGCCCTTGGCAACCTTTCTGGCCAAACTATGAAAGGGAAA

Reverse complement sequence

TTTCCCTTTCATAGTTTGGCCAGAAAGGTTGCCAAGGGCCGGATAATCGTTGATGGTACAAAACAGCATCGCATGGAGGTTGAAATACTCTTGTGCATAT[G/A]
CGTCCCATGTTCGTGTTCCCTCATTCCATAGCCTTTCGAAGTCAGCGATTATCGGTTCAAGGAATACATCGATATCGTTGCCAGGTTGTCTCGGTCCTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.10% 9.50% 21.35% 27.02% NA
All Indica  2759 15.00% 7.40% 34.65% 42.91% NA
All Japonica  1512 97.00% 0.10% 1.65% 1.32% NA
Aus  269 2.60% 87.70% 2.60% 7.06% NA
Indica I  595 4.70% 4.70% 27.73% 62.86% NA
Indica II  465 19.40% 0.20% 26.24% 54.19% NA
Indica III  913 22.80% 9.20% 43.92% 24.10% NA
Indica Intermediate  786 11.20% 11.70% 34.10% 43.00% NA
Temperate Japonica  767 98.00% 0.00% 0.78% 1.17% NA
Tropical Japonica  504 94.80% 0.20% 3.57% 1.39% NA
Japonica Intermediate  241 97.90% 0.00% 0.41% 1.66% NA
VI/Aromatic  96 53.10% 1.00% 9.38% 36.46% NA
Intermediate  90 56.70% 8.90% 13.33% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113862383 C -> T LOC_Os01g24610.1 missense_variant ; p.Ala228Val; MODERATE nonsynonymous_codon ; A228V Average:6.149; most accessible tissue: Minghui63 young leaf, score: 9.976 benign 1.126 TOLERATED 0.06
vg0113862383 C -> DEL LOC_Os01g24610.1 N frameshift_variant Average:6.149; most accessible tissue: Minghui63 young leaf, score: 9.976 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113862383 NA 5.68E-07 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113862383 NA 1.52E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113862383 NA 3.09E-24 mr1095 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113862383 NA 1.32E-14 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113862383 NA 2.71E-10 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113862383 NA 1.82E-23 mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113862383 NA 2.22E-06 mr1210 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113862383 NA 4.72E-26 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113862383 NA 1.75E-07 mr1305 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113862383 NA 4.15E-07 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113862383 NA 7.22E-27 mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113862383 NA 1.35E-09 mr1586 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113862383 NA 2.79E-22 mr1589 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113862383 NA 1.34E-07 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113862383 NA 2.74E-17 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113862383 NA 1.53E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113862383 NA 1.23E-24 mr1868 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113862383 NA 4.57E-12 mr1918 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113862383 NA 8.49E-21 mr1095_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113862383 NA 3.39E-23 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113862383 NA 4.85E-06 mr1305_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113862383 NA 2.14E-13 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113862383 NA 1.92E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251