Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113849031:

Variant ID: vg0113849031 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 13849031
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, C: 0.08, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:

CGCCGTGGCACTTGTACGTCTTGCCGAACTTGGCCATCCACTCCTCGAACATCTGCATCGTCACGCCGTCATCGCTGCCGTTGTTGTAGTAGGCGCTCGC[T/C]
GCCATTGCCTGCAAAGCCATCAACGTGCACACAAGCAGTACTATGCTAGTCATCGGACGCGAAGGCGCCATCATCTCAAGTGTGACTTATCAGTTCTAAG

Reverse complement sequence

CTTAGAACTGATAAGTCACACTTGAGATGATGGCGCCTTCGCGTCCGATGACTAGCATAGTACTGCTTGTGTGCACGTTGATGGCTTTGCAGGCAATGGC[A/G]
GCGAGCGCCTACTACAACAACGGCAGCGATGACGGCGTGACGATGCAGATGTTCGAGGAGTGGATGGCCAAGTTCGGCAAGACGTACAAGTGCCACGGCG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.30%	18.60%	1.08%	3.07%	NA
All Indica	2759	73.90%	19.10%	1.81%	5.15%	NA
All Japonica	1512	95.10%	4.90%	0.00%	0.00%	NA
Aus	269	12.60%	87.40%	0.00%	0.00%	NA
Indica I	595	79.20%	20.50%	0.34%	0.00%	NA
Indica II	465	98.50%	1.30%	0.00%	0.22%	NA
Indica III	913	61.40%	24.10%	2.63%	11.83%	NA
Indica Intermediate	786	70.00%	22.80%	3.05%	4.20%	NA
Temperate Japonica	767	98.20%	1.80%	0.00%	0.00%	NA
Tropical Japonica	504	89.10%	10.90%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	74.00%	26.00%	0.00%	0.00%	NA
Intermediate	90	77.80%	17.80%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0113849031	T -> DEL	LOC_Os01g24570.1	N	frameshift_variant	Average:65.341; most accessible tissue: Minghui63 root, score: 78.091	N	N	N	N
vg0113849031	T -> C	LOC_Os01g24570.1	synonymous_variant ; p.Ala2Ala; LOW	synonymous_codon	Average:65.341; most accessible tissue: Minghui63 root, score: 78.091	N	N	N	N
vg0113849031	T -> C	LOC_Os01g24570.1	synonymous_variant ; p.Ala2Ala; LOW	nonsynonymous_codon ; A2G	Average:65.341; most accessible tissue: Minghui63 root, score: 78.091	unknown	unknown	TOLERATED	0.23

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0113849031	NA	1.76E-08	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113849031	NA	2.70E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113849031	NA	1.56E-07	mr1059	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113849031	NA	3.43E-06	mr1066	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113849031	NA	8.50E-23	mr1095	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113849031	NA	1.92E-07	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113849031	NA	7.74E-07	mr1351	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113849031	NA	6.92E-07	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113849031	NA	1.82E-09	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113849031	NA	6.88E-07	mr1397	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113849031	NA	1.09E-08	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113849031	9.37E-06	9.34E-06	mr1455	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113849031	NA	5.67E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113849031	NA	6.62E-09	mr1535	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113849031	NA	2.95E-08	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113849031	NA	4.91E-23	mr1589	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113849031	NA	7.79E-06	mr1589	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113849031	NA	1.15E-06	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113849031	NA	1.38E-09	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113849031	NA	3.95E-07	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113849031	NA	6.74E-06	mr1738	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113849031	NA	2.75E-06	mr1749	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113849031	NA	6.20E-16	mr1765	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113849031	NA	1.10E-08	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113849031	NA	8.27E-06	mr1912	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113849031	NA	1.76E-07	mr1931	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113849031	NA	1.44E-07	mr1950	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113849031	NA	6.40E-07	mr1042_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113849031	NA	1.00E-14	mr1794_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251