Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113847918:

Variant ID: vg0113847918 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 13847918
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACAAGCATTCATTTCATTAATTAATCTCTCAAACGCAAGTACGTATAACTCGACAATTATTCCTTATTCCACGTGAGGAATTAACGGGAGGGATAAGAG[G/A]
AAGAGAAGATGCTAGAGGGGGAGGACGACGCCAGTGGCAATCGAGGTCGACGAGGTGGCCGGCTAGCTAGCTACTAGACGGTGGGGTAGAAAGGTGAGAC

Reverse complement sequence

GTCTCACCTTTCTACCCCACCGTCTAGTAGCTAGCTAGCCGGCCACCTCGTCGACCTCGATTGCCACTGGCGTCGTCCTCCCCCTCTAGCATCTTCTCTT[C/T]
CTCTTATCCCTCCCGTTAATTCCTCACGTGGAATAAGGAATAATTGTCGAGTTATACGTACTTGCGTTTGAGAGATTAATTAATGAAATGAATGCTTGTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.60%	14.10%	0.15%	3.13%	NA
All Indica	2759	85.20%	13.00%	0.07%	1.70%	NA
All Japonica	1512	92.50%	2.10%	0.26%	5.09%	NA
Aus	269	12.30%	87.40%	0.00%	0.37%	NA
Indica I	595	95.50%	4.50%	0.00%	0.00%	NA
Indica II	465	98.90%	0.60%	0.00%	0.43%	NA
Indica III	913	71.70%	23.20%	0.22%	4.82%	NA
Indica Intermediate	786	84.90%	15.00%	0.00%	0.13%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	80.80%	6.00%	0.79%	12.50%	NA
Japonica Intermediate	241	93.40%	0.80%	0.00%	5.81%	NA
VI/Aromatic	96	52.10%	26.00%	1.04%	20.83%	NA
Intermediate	90	81.10%	15.60%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0113847918	G -> A	LOC_Os01g24560.1	downstream_gene_variant ; 4169.0bp to feature; MODIFIER	silent_mutation	Average:70.626; most accessible tissue: Minghui63 root, score: 84.323	N	N	N	N
vg0113847918	G -> A	LOC_Os01g24570.1	downstream_gene_variant ; 74.0bp to feature; MODIFIER	silent_mutation	Average:70.626; most accessible tissue: Minghui63 root, score: 84.323	N	N	N	N
vg0113847918	G -> A	LOC_Os01g24560-LOC_Os01g24570	intergenic_region ; MODIFIER	silent_mutation	Average:70.626; most accessible tissue: Minghui63 root, score: 84.323	N	N	N	N
vg0113847918	G -> DEL	N	N	silent_mutation	Average:70.626; most accessible tissue: Minghui63 root, score: 84.323	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0113847918	NA	2.33E-06	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113847918	NA	8.82E-25	mr1095	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113847918	NA	7.05E-29	mr1098	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113847918	NA	2.27E-14	mr1180	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113847918	NA	1.29E-06	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113847918	NA	2.26E-13	mr1183	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113847918	NA	6.16E-22	mr1210	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113847918	NA	1.27E-12	mr1503	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113847918	NA	1.32E-25	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113847918	NA	2.09E-23	mr1589	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113847918	NA	2.35E-08	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113847918	1.68E-06	2.18E-07	mr1739	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113847918	NA	1.07E-12	mr1739	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113847918	NA	3.76E-17	mr1765	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113847918	NA	2.39E-25	mr1868	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113847918	NA	2.61E-18	mr1911	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113847918	NA	2.29E-15	mr1918	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113847918	NA	4.75E-06	mr1931	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113847918	NA	6.96E-22	mr1095_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113847918	NA	5.45E-16	mr1180_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113847918	NA	2.24E-06	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113847918	NA	6.14E-20	mr1305_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113847918	NA	7.91E-06	mr1360_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113847918	NA	6.69E-12	mr1409_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113847918	NA	1.37E-09	mr1739_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113847918	NA	1.11E-10	mr1739_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113847918	NA	9.61E-16	mr1794_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251