\
| Variant ID: vg0113762419 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr01 | Position: 13762419 |
| Reference Allele: T | Alternative Allele: TTA,A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTCCACAGAGGGAGAAGGATGTGCTAAGACAGGCGCTGGGGAATCGGGAGCATGGAGGCCGGGTTCGAGGCGTATCCTCTAAGCTGAGTTGGAAAGAAGG[T/TTA,A]
TTCAAACAGGACGCCTCCTCATACAAGAAATGTGACGCCTATAAGGACAAGTTGAGGGACGAAGGGGGTAAGCAGTTTGAAAAAGAATTGATTGATTTCT
AGAAATCAATCAATTCTTTTTCAAACTGCTTACCCCCTTCGTCCCTCAACTTGTCCTTATAGGCGTCACATTTCTTGTATGAGGAGGCGTCCTGTTTGAA[A/TAA,T]
CCTTCTTTCCAACTCAGCTTAGAGGATACGCCTCGAACCCGGCCTCCATGCTCCCGATTCCCCAGCGCCTGTCTTAGCACATCCTTCTCCCTCTGTGGAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.80% | 12.30% | 2.69% | 34.85% | TTA: 2.39% |
| All Indica | 2759 | 26.70% | 11.90% | 4.24% | 54.15% | TTA: 3.04% |
| All Japonica | 1512 | 95.10% | 0.30% | 0.33% | 2.38% | TTA: 1.92% |
| Aus | 269 | 2.20% | 88.10% | 0.00% | 9.67% | NA |
| Indica I | 595 | 31.30% | 6.70% | 5.04% | 46.05% | TTA: 10.92% |
| Indica II | 465 | 19.80% | 12.30% | 3.23% | 63.87% | TTA: 0.86% |
| Indica III | 913 | 26.40% | 13.30% | 1.86% | 58.49% | NA |
| Indica Intermediate | 786 | 27.60% | 14.00% | 7.00% | 49.49% | TTA: 1.91% |
| Temperate Japonica | 767 | 98.60% | 0.00% | 0.39% | 0.26% | TTA: 0.78% |
| Tropical Japonica | 504 | 88.90% | 0.80% | 0.40% | 5.95% | TTA: 3.97% |
| Japonica Intermediate | 241 | 97.10% | 0.00% | 0.00% | 1.66% | TTA: 1.24% |
| VI/Aromatic | 96 | 29.20% | 3.10% | 3.12% | 64.58% | NA |
| Intermediate | 90 | 55.60% | 10.00% | 2.22% | 32.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0113762419 | T -> A | LOC_Os01g24410.1 | synonymous_variant ; p.Gly177Gly; LOW | synonymous_codon | Average:22.446; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| vg0113762419 | T -> TTA | LOC_Os01g24410.1 | frameshift_variant ; p.Phe178fs; HIGH | frameshift_variant | Average:22.446; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| vg0113762419 | T -> DEL | LOC_Os01g24410.1 | N | frameshift_variant | Average:22.446; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0113762419 | NA | 2.68E-07 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113762419 | NA | 2.26E-06 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113762419 | NA | 2.01E-07 | mr1369 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113762419 | NA | 1.26E-08 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113762419 | NA | 4.19E-07 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113762419 | NA | 5.58E-07 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113762419 | 3.35E-06 | 3.36E-06 | mr1674 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113762419 | NA | 1.00E-05 | mr1952 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |