\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113720193:

Variant ID: vg0113720193 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13720193
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


TTTCCCCTTCCTCTGTGACCCGTGCAGAGGAAAGGGAAAAAAGAAGAATGAGAAGAAAACGAAAAAGAAAAAGAAAAAAAGAAAAAAAGAGAAAAGGACA[T/C]
GTCACGTCCATGTGGCATTGCCACATCAGCGCCACGTAGGATTCTAGAGTGGATGTGTCAATTTGAGACCTAGATGATACACTTTGACAAGTTATAGAAC

Reverse complement sequence

GTTCTATAACTTGTCAAAGTGTATCATCTAGGTCTCAAATTGACACATCCACTCTAGAATCCTACGTGGCGCTGATGTGGCAATGCCACATGGACGTGAC[A/G]
TGTCCTTTTCTCTTTTTTTCTTTTTTTCTTTTTCTTTTTCGTTTTCTTCTCATTCTTCTTTTTTCCCTTTCCTCTGCACGGGTCACAGAGGAAGGGGAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.90% 6.30% 1.10% 57.64% NA
All Indica  2759 5.10% 10.70% 1.74% 82.46% NA
All Japonica  1512 95.10% 0.00% 0.07% 4.83% NA
Aus  269 0.70% 0.40% 0.74% 98.14% NA
Indica I  595 3.00% 26.40% 1.51% 69.08% NA
Indica II  465 4.30% 4.70% 1.51% 89.46% NA
Indica III  913 7.10% 6.60% 1.31% 84.99% NA
Indica Intermediate  786 4.70% 7.30% 2.54% 85.50% NA
Temperate Japonica  767 98.40% 0.00% 0.00% 1.56% NA
Tropical Japonica  504 89.10% 0.00% 0.00% 10.91% NA
Japonica Intermediate  241 97.10% 0.00% 0.41% 2.49% NA
VI/Aromatic  96 27.10% 0.00% 0.00% 72.92% NA
Intermediate  90 48.90% 3.30% 1.11% 46.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113720193 T -> DEL N N silent_mutation Average:28.771; most accessible tissue: Callus, score: 66.149 N N N N
vg0113720193 T -> C LOC_Os01g24350.1 downstream_gene_variant ; 650.0bp to feature; MODIFIER silent_mutation Average:28.771; most accessible tissue: Callus, score: 66.149 N N N N
vg0113720193 T -> C LOC_Os01g24350-LOC_Os01g24360 intergenic_region ; MODIFIER silent_mutation Average:28.771; most accessible tissue: Callus, score: 66.149 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113720193 NA 6.67E-14 Grain_thickness Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0113720193 NA 5.82E-13 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0113720193 NA 5.72E-13 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113720193 NA 5.42E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113720193 NA 1.36E-12 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113720193 NA 1.27E-23 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113720193 NA 6.14E-13 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113720193 NA 2.32E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113720193 NA 1.06E-27 mr1149_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113720193 NA 2.12E-07 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113720193 NA 3.18E-07 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113720193 NA 7.58E-07 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113720193 NA 3.63E-29 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113720193 NA 6.47E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113720193 NA 1.32E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113720193 NA 5.66E-09 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113720193 NA 3.76E-09 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113720193 NA 8.84E-06 mr1654_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113720193 NA 7.24E-19 mr1874_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113720193 NA 2.27E-12 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113720193 NA 4.96E-09 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113720193 NA 4.96E-09 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251