\
| Variant ID: vg0113685893 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 13685893 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 117. )
TATCTCCCATTAATTGCTCTCTGAAAACACCGTCTTGAAGTGTCTTCATCTCCTTCGAAGTCTTCAAACGCTTGTCAATGACGTCTTCAAAATTGCTTCC[C/T]
ATCAAGGTCTTGTAATCTTCAACCGACATGTCGTCTTGCTTGAAATACCGAAGAGAGCCAAGATTTACCTCAACTGGCAAAACGGCAATTTCAACAATGT
ACATTGTTGAAATTGCCGTTTTGCCAGTTGAGGTAAATCTTGGCTCTCTTCGGTATTTCAAGCAAGACGACATGTCGGTTGAAGATTACAAGACCTTGAT[G/A]
GGAAGCAATTTTGAAGACGTCATTGACAAGCGTTTGAAGACTTCGAAGGAGATGAAGACACTTCAAGACGGTGTTTTCAGAGAGCAATTAATGGGAGATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.80% | 8.60% | 21.01% | 3.62% | NA |
| All Indica | 2759 | 55.30% | 13.20% | 30.70% | 0.83% | NA |
| All Japonica | 1512 | 88.20% | 0.40% | 1.92% | 9.46% | NA |
| Aus | 269 | 69.10% | 3.00% | 27.14% | 0.74% | NA |
| Indica I | 595 | 47.60% | 3.50% | 48.57% | 0.34% | NA |
| Indica II | 465 | 37.20% | 24.50% | 37.42% | 0.86% | NA |
| Indica III | 913 | 66.20% | 15.00% | 16.98% | 1.86% | NA |
| Indica Intermediate | 786 | 59.30% | 11.60% | 29.13% | 0.00% | NA |
| Temperate Japonica | 767 | 98.70% | 0.10% | 0.39% | 0.78% | NA |
| Tropical Japonica | 504 | 69.80% | 0.20% | 4.96% | 25.00% | NA |
| Japonica Intermediate | 241 | 93.40% | 1.70% | 0.41% | 4.56% | NA |
| VI/Aromatic | 96 | 47.90% | 27.10% | 25.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 2.20% | 22.22% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0113685893 | C -> T | LOC_Os01g24294.1 | missense_variant ; p.Met1612Ile; MODERATE | nonsynonymous_codon ; M1612I | Average:17.66; most accessible tissue: Callus, score: 37.475 | benign |
1.136 |
DELETERIOUS | 0.01 |
| vg0113685893 | C -> DEL | LOC_Os01g24294.1 | N | frameshift_variant | Average:17.66; most accessible tissue: Callus, score: 37.475 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0113685893 | NA | 4.09E-10 | mr1175 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113685893 | NA | 2.53E-11 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113685893 | NA | 2.39E-09 | mr1716 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113685893 | NA | 6.51E-06 | mr1716 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113685893 | NA | 3.62E-06 | mr1952 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113685893 | NA | 2.43E-07 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |