\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113615260:

Variant ID: vg0113615260 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13615260
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGTCCATCAACTACAGTAAATTCTTGGGAGGGATATGGCATTAATGGATACTCGTTTAGTACAAGAGCCCGAGATAGTAAGACCTGTACGCAAAATAGC[A/G]
GTATCCGTGTGGAGGCAATTGATGAAGCGGGGGAAAAACAATCATACTTCGGGTTTGCTGAAGAAATATAGGAAATCGACTATGGACACACAATGCAATT

Reverse complement sequence

AATTGCATTGTGTGTCCATAGTCGATTTCCTATATTTCTTCAGCAAACCCGAAGTATGATTGTTTTTCCCCCGCTTCATCAATTGCCTCCACACGGATAC[T/C]
GCTATTTTGCGTACAGGTCTTACTATCTCGGGCTCTTGTACTAAACGAGTATCCATTAATGCCATATCCCTCCCAAGAATTTACTGTAGTTGATGGACCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.00% 0.30% 3.68% 47.02% NA
All Indica  2759 32.40% 0.20% 3.81% 63.61% NA
All Japonica  1512 87.00% 0.30% 2.05% 10.65% NA
Aus  269 10.80% 0.70% 4.46% 84.01% NA
Indica I  595 55.60% 0.20% 0.50% 43.70% NA
Indica II  465 19.80% 0.00% 3.66% 76.56% NA
Indica III  913 24.60% 0.20% 7.12% 68.02% NA
Indica Intermediate  786 31.30% 0.30% 2.54% 65.90% NA
Temperate Japonica  767 98.80% 0.10% 0.13% 0.91% NA
Tropical Japonica  504 66.10% 0.60% 5.75% 27.58% NA
Japonica Intermediate  241 92.90% 0.40% 0.41% 6.22% NA
VI/Aromatic  96 29.20% 1.00% 20.83% 48.96% NA
Intermediate  90 56.70% 0.00% 6.67% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113615260 A -> G LOC_Os01g24150.1 upstream_gene_variant ; 2248.0bp to feature; MODIFIER silent_mutation Average:22.542; most accessible tissue: Callus, score: 48.834 N N N N
vg0113615260 A -> G LOC_Os01g24140.1 downstream_gene_variant ; 232.0bp to feature; MODIFIER silent_mutation Average:22.542; most accessible tissue: Callus, score: 48.834 N N N N
vg0113615260 A -> G LOC_Os01g24140-LOC_Os01g24150 intergenic_region ; MODIFIER silent_mutation Average:22.542; most accessible tissue: Callus, score: 48.834 N N N N
vg0113615260 A -> DEL N N silent_mutation Average:22.542; most accessible tissue: Callus, score: 48.834 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113615260 NA 8.90E-07 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113615260 NA 7.06E-07 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113615260 NA 1.83E-10 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113615260 NA 1.80E-12 mr1722 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113615260 NA 9.29E-08 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113615260 NA 8.14E-07 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251