| Variant ID: vg0113615260 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 13615260 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TGGTCCATCAACTACAGTAAATTCTTGGGAGGGATATGGCATTAATGGATACTCGTTTAGTACAAGAGCCCGAGATAGTAAGACCTGTACGCAAAATAGC[A/G]
GTATCCGTGTGGAGGCAATTGATGAAGCGGGGGAAAAACAATCATACTTCGGGTTTGCTGAAGAAATATAGGAAATCGACTATGGACACACAATGCAATT
AATTGCATTGTGTGTCCATAGTCGATTTCCTATATTTCTTCAGCAAACCCGAAGTATGATTGTTTTTCCCCCGCTTCATCAATTGCCTCCACACGGATAC[T/C]
GCTATTTTGCGTACAGGTCTTACTATCTCGGGCTCTTGTACTAAACGAGTATCCATTAATGCCATATCCCTCCCAAGAATTTACTGTAGTTGATGGACCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.00% | 0.30% | 3.68% | 47.02% | NA |
| All Indica | 2759 | 32.40% | 0.20% | 3.81% | 63.61% | NA |
| All Japonica | 1512 | 87.00% | 0.30% | 2.05% | 10.65% | NA |
| Aus | 269 | 10.80% | 0.70% | 4.46% | 84.01% | NA |
| Indica I | 595 | 55.60% | 0.20% | 0.50% | 43.70% | NA |
| Indica II | 465 | 19.80% | 0.00% | 3.66% | 76.56% | NA |
| Indica III | 913 | 24.60% | 0.20% | 7.12% | 68.02% | NA |
| Indica Intermediate | 786 | 31.30% | 0.30% | 2.54% | 65.90% | NA |
| Temperate Japonica | 767 | 98.80% | 0.10% | 0.13% | 0.91% | NA |
| Tropical Japonica | 504 | 66.10% | 0.60% | 5.75% | 27.58% | NA |
| Japonica Intermediate | 241 | 92.90% | 0.40% | 0.41% | 6.22% | NA |
| VI/Aromatic | 96 | 29.20% | 1.00% | 20.83% | 48.96% | NA |
| Intermediate | 90 | 56.70% | 0.00% | 6.67% | 36.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0113615260 | A -> G | LOC_Os01g24150.1 | upstream_gene_variant ; 2248.0bp to feature; MODIFIER | silent_mutation | Average:22.542; most accessible tissue: Callus, score: 48.834 | N | N | N | N |
| vg0113615260 | A -> G | LOC_Os01g24140.1 | downstream_gene_variant ; 232.0bp to feature; MODIFIER | silent_mutation | Average:22.542; most accessible tissue: Callus, score: 48.834 | N | N | N | N |
| vg0113615260 | A -> G | LOC_Os01g24140-LOC_Os01g24150 | intergenic_region ; MODIFIER | silent_mutation | Average:22.542; most accessible tissue: Callus, score: 48.834 | N | N | N | N |
| vg0113615260 | A -> DEL | N | N | silent_mutation | Average:22.542; most accessible tissue: Callus, score: 48.834 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0113615260 | NA | 8.90E-07 | mr1064 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113615260 | NA | 7.06E-07 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113615260 | NA | 1.83E-10 | mr1471 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113615260 | NA | 1.80E-12 | mr1722 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113615260 | NA | 9.29E-08 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113615260 | NA | 8.14E-07 | mr1519_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |