\
| Variant ID: vg0113567574 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr01 | Position: 13567574 |
| Reference Allele: C | Alternative Allele: T,CGT,G |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTCTTCATTAATAAATACTCCCTCCGTTTTACAATGTAAGTCATTCTAGCATTTATCACATTCATATTAATATTAATGAATCTAGACATATATCTATCTA[C/T,CGT,G]
ATTCATTAGCATCAATATAAATGCTAAAATGAAACGGAGGAAGTAGCTAAAATTAGATGTGACATCTGTCTCTTTTACTACTACCATATTTTTAATTCAT
ATGAATTAAAAATATGGTAGTAGTAAAAGAGACAGATGTCACATCTAATTTTAGCTACTTCCTCCGTTTCATTTTAGCATTTATATTGATGCTAATGAAT[G/A,ACG,C]
TAGATAGATATATGTCTAGATTCATTAATATTAATATGAATGTGATAAATGCTAGAATGACTTACATTGTAAAACGGAGGGAGTATTTATTAATGAAGAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.10% | 14.30% | 1.02% | 20.38% | CGT: 1.14%; G: 0.04% |
| All Indica | 2759 | 55.30% | 8.90% | 1.56% | 32.26% | CGT: 1.96% |
| All Japonica | 1512 | 88.30% | 11.60% | 0.00% | 0.13% | NA |
| Aus | 269 | 3.30% | 90.30% | 0.00% | 6.32% | NA |
| Indica I | 595 | 93.60% | 4.00% | 0.00% | 2.35% | NA |
| Indica II | 465 | 49.90% | 2.20% | 2.37% | 45.59% | NA |
| Indica III | 913 | 36.10% | 11.10% | 1.86% | 46.22% | CGT: 4.71% |
| Indica Intermediate | 786 | 51.90% | 14.00% | 1.91% | 30.79% | CGT: 1.40% |
| Temperate Japonica | 767 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 69.40% | 30.40% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 94.20% | 5.40% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 53.10% | 0.00% | 3.12% | 43.75% | NA |
| Intermediate | 90 | 66.70% | 15.60% | 2.22% | 13.33% | G: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0113567574 | C -> G | LOC_Os01g24070.1 | upstream_gene_variant ; 3033.0bp to feature; MODIFIER | silent_mutation | Average:67.96; most accessible tissue: Callus, score: 92.69 | N | N | N | N |
| vg0113567574 | C -> G | LOC_Os01g24070.2 | upstream_gene_variant ; 3086.0bp to feature; MODIFIER | silent_mutation | Average:67.96; most accessible tissue: Callus, score: 92.69 | N | N | N | N |
| vg0113567574 | C -> G | LOC_Os01g24060.1 | downstream_gene_variant ; 701.0bp to feature; MODIFIER | silent_mutation | Average:67.96; most accessible tissue: Callus, score: 92.69 | N | N | N | N |
| vg0113567574 | C -> G | LOC_Os01g24060.2 | downstream_gene_variant ; 701.0bp to feature; MODIFIER | silent_mutation | Average:67.96; most accessible tissue: Callus, score: 92.69 | N | N | N | N |
| vg0113567574 | C -> G | LOC_Os01g24060-LOC_Os01g24070 | intergenic_region ; MODIFIER | silent_mutation | Average:67.96; most accessible tissue: Callus, score: 92.69 | N | N | N | N |
| vg0113567574 | C -> T | LOC_Os01g24070.1 | upstream_gene_variant ; 3033.0bp to feature; MODIFIER | silent_mutation | Average:67.96; most accessible tissue: Callus, score: 92.69 | N | N | N | N |
| vg0113567574 | C -> T | LOC_Os01g24070.2 | upstream_gene_variant ; 3086.0bp to feature; MODIFIER | silent_mutation | Average:67.96; most accessible tissue: Callus, score: 92.69 | N | N | N | N |
| vg0113567574 | C -> T | LOC_Os01g24060.1 | downstream_gene_variant ; 701.0bp to feature; MODIFIER | silent_mutation | Average:67.96; most accessible tissue: Callus, score: 92.69 | N | N | N | N |
| vg0113567574 | C -> T | LOC_Os01g24060.2 | downstream_gene_variant ; 701.0bp to feature; MODIFIER | silent_mutation | Average:67.96; most accessible tissue: Callus, score: 92.69 | N | N | N | N |
| vg0113567574 | C -> T | LOC_Os01g24060-LOC_Os01g24070 | intergenic_region ; MODIFIER | silent_mutation | Average:67.96; most accessible tissue: Callus, score: 92.69 | N | N | N | N |
| vg0113567574 | C -> DEL | N | N | silent_mutation | Average:67.96; most accessible tissue: Callus, score: 92.69 | N | N | N | N |
| vg0113567574 | C -> CGT | LOC_Os01g24070.1 | upstream_gene_variant ; 3032.0bp to feature; MODIFIER | silent_mutation | Average:67.96; most accessible tissue: Callus, score: 92.69 | N | N | N | N |
| vg0113567574 | C -> CGT | LOC_Os01g24070.2 | upstream_gene_variant ; 3085.0bp to feature; MODIFIER | silent_mutation | Average:67.96; most accessible tissue: Callus, score: 92.69 | N | N | N | N |
| vg0113567574 | C -> CGT | LOC_Os01g24060.1 | downstream_gene_variant ; 702.0bp to feature; MODIFIER | silent_mutation | Average:67.96; most accessible tissue: Callus, score: 92.69 | N | N | N | N |
| vg0113567574 | C -> CGT | LOC_Os01g24060.2 | downstream_gene_variant ; 702.0bp to feature; MODIFIER | silent_mutation | Average:67.96; most accessible tissue: Callus, score: 92.69 | N | N | N | N |
| vg0113567574 | C -> CGT | LOC_Os01g24060-LOC_Os01g24070 | intergenic_region ; MODIFIER | silent_mutation | Average:67.96; most accessible tissue: Callus, score: 92.69 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0113567574 | NA | 7.21E-06 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113567574 | NA | 2.45E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113567574 | NA | 3.32E-06 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113567574 | NA | 4.80E-06 | mr1073 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113567574 | NA | 1.22E-06 | mr1230 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113567574 | NA | 9.92E-07 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113567574 | NA | 3.12E-06 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113567574 | NA | 2.77E-10 | mr1471 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113567574 | NA | 4.92E-07 | mr1530 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113567574 | NA | 2.07E-06 | mr1634 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113567574 | NA | 9.72E-12 | mr1696 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113567574 | NA | 6.24E-06 | mr1808 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113567574 | NA | 4.60E-13 | mr1047_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113567574 | NA | 7.01E-11 | mr1471_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113567574 | NA | 1.72E-15 | mr1530_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113567574 | NA | 6.23E-11 | mr1642_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113567574 | NA | 1.41E-07 | mr1792_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113567574 | NA | 9.37E-13 | mr1803_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113567574 | NA | 1.19E-10 | mr1808_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113567574 | NA | 4.28E-10 | mr1815_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |