\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113567574:

Variant ID: vg0113567574 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 13567574
Reference Allele: CAlternative Allele: T,CGT,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCTTCATTAATAAATACTCCCTCCGTTTTACAATGTAAGTCATTCTAGCATTTATCACATTCATATTAATATTAATGAATCTAGACATATATCTATCTA[C/T,CGT,G]
ATTCATTAGCATCAATATAAATGCTAAAATGAAACGGAGGAAGTAGCTAAAATTAGATGTGACATCTGTCTCTTTTACTACTACCATATTTTTAATTCAT

Reverse complement sequence

ATGAATTAAAAATATGGTAGTAGTAAAAGAGACAGATGTCACATCTAATTTTAGCTACTTCCTCCGTTTCATTTTAGCATTTATATTGATGCTAATGAAT[G/A,ACG,C]
TAGATAGATATATGTCTAGATTCATTAATATTAATATGAATGTGATAAATGCTAGAATGACTTACATTGTAAAACGGAGGGAGTATTTATTAATGAAGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.10% 14.30% 1.02% 20.38% CGT: 1.14%; G: 0.04%
All Indica  2759 55.30% 8.90% 1.56% 32.26% CGT: 1.96%
All Japonica  1512 88.30% 11.60% 0.00% 0.13% NA
Aus  269 3.30% 90.30% 0.00% 6.32% NA
Indica I  595 93.60% 4.00% 0.00% 2.35% NA
Indica II  465 49.90% 2.20% 2.37% 45.59% NA
Indica III  913 36.10% 11.10% 1.86% 46.22% CGT: 4.71%
Indica Intermediate  786 51.90% 14.00% 1.91% 30.79% CGT: 1.40%
Temperate Japonica  767 98.80% 1.20% 0.00% 0.00% NA
Tropical Japonica  504 69.40% 30.40% 0.00% 0.20% NA
Japonica Intermediate  241 94.20% 5.40% 0.00% 0.41% NA
VI/Aromatic  96 53.10% 0.00% 3.12% 43.75% NA
Intermediate  90 66.70% 15.60% 2.22% 13.33% G: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113567574 C -> G LOC_Os01g24070.1 upstream_gene_variant ; 3033.0bp to feature; MODIFIER silent_mutation Average:67.96; most accessible tissue: Callus, score: 92.69 N N N N
vg0113567574 C -> G LOC_Os01g24070.2 upstream_gene_variant ; 3086.0bp to feature; MODIFIER silent_mutation Average:67.96; most accessible tissue: Callus, score: 92.69 N N N N
vg0113567574 C -> G LOC_Os01g24060.1 downstream_gene_variant ; 701.0bp to feature; MODIFIER silent_mutation Average:67.96; most accessible tissue: Callus, score: 92.69 N N N N
vg0113567574 C -> G LOC_Os01g24060.2 downstream_gene_variant ; 701.0bp to feature; MODIFIER silent_mutation Average:67.96; most accessible tissue: Callus, score: 92.69 N N N N
vg0113567574 C -> G LOC_Os01g24060-LOC_Os01g24070 intergenic_region ; MODIFIER silent_mutation Average:67.96; most accessible tissue: Callus, score: 92.69 N N N N
vg0113567574 C -> T LOC_Os01g24070.1 upstream_gene_variant ; 3033.0bp to feature; MODIFIER silent_mutation Average:67.96; most accessible tissue: Callus, score: 92.69 N N N N
vg0113567574 C -> T LOC_Os01g24070.2 upstream_gene_variant ; 3086.0bp to feature; MODIFIER silent_mutation Average:67.96; most accessible tissue: Callus, score: 92.69 N N N N
vg0113567574 C -> T LOC_Os01g24060.1 downstream_gene_variant ; 701.0bp to feature; MODIFIER silent_mutation Average:67.96; most accessible tissue: Callus, score: 92.69 N N N N
vg0113567574 C -> T LOC_Os01g24060.2 downstream_gene_variant ; 701.0bp to feature; MODIFIER silent_mutation Average:67.96; most accessible tissue: Callus, score: 92.69 N N N N
vg0113567574 C -> T LOC_Os01g24060-LOC_Os01g24070 intergenic_region ; MODIFIER silent_mutation Average:67.96; most accessible tissue: Callus, score: 92.69 N N N N
vg0113567574 C -> DEL N N silent_mutation Average:67.96; most accessible tissue: Callus, score: 92.69 N N N N
vg0113567574 C -> CGT LOC_Os01g24070.1 upstream_gene_variant ; 3032.0bp to feature; MODIFIER silent_mutation Average:67.96; most accessible tissue: Callus, score: 92.69 N N N N
vg0113567574 C -> CGT LOC_Os01g24070.2 upstream_gene_variant ; 3085.0bp to feature; MODIFIER silent_mutation Average:67.96; most accessible tissue: Callus, score: 92.69 N N N N
vg0113567574 C -> CGT LOC_Os01g24060.1 downstream_gene_variant ; 702.0bp to feature; MODIFIER silent_mutation Average:67.96; most accessible tissue: Callus, score: 92.69 N N N N
vg0113567574 C -> CGT LOC_Os01g24060.2 downstream_gene_variant ; 702.0bp to feature; MODIFIER silent_mutation Average:67.96; most accessible tissue: Callus, score: 92.69 N N N N
vg0113567574 C -> CGT LOC_Os01g24060-LOC_Os01g24070 intergenic_region ; MODIFIER silent_mutation Average:67.96; most accessible tissue: Callus, score: 92.69 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113567574 NA 7.21E-06 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113567574 NA 2.45E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113567574 NA 3.32E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113567574 NA 4.80E-06 mr1073 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113567574 NA 1.22E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113567574 NA 9.92E-07 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113567574 NA 3.12E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113567574 NA 2.77E-10 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113567574 NA 4.92E-07 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113567574 NA 2.07E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113567574 NA 9.72E-12 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113567574 NA 6.24E-06 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113567574 NA 4.60E-13 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113567574 NA 7.01E-11 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113567574 NA 1.72E-15 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113567574 NA 6.23E-11 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113567574 NA 1.41E-07 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113567574 NA 9.37E-13 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113567574 NA 1.19E-10 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113567574 NA 4.28E-10 mr1815_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251