Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113550043:

Variant ID: vg0113550043 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 13550043
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:

CCTAGGATGGTGTCTATGGTATTAACTACATTGCCATGTAGGACTTTTAGCTTACGTAACACTATATTAATTAAGAGAGAGTGAAGAGAGGAGGAAACTG[G/A]
GTCTCATGCAAGACACAGCTTCAACACGAGAATCTATGCACTAGACACTATCAAGTTTTGCATTTGGAGAGAATAATGTTTTCATAATAGATGAAGAATA

Reverse complement sequence

TATTCTTCATCTATTATGAAAACATTATTCTCTCCAAATGCAAAACTTGATAGTGTCTAGTGCATAGATTCTCGTGTTGAAGCTGTGTCTTGCATGAGAC[C/T]
CAGTTTCCTCCTCTCTTCACTCTCTCTTAATTAATATAGTGTTACGTAAGCTAAAAGTCCTACATGGCAATGTAGTTAATACCATAGACACCATCCTAGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.60%	20.70%	0.59%	21.14%	NA
All Indica	2759	34.30%	31.30%	0.94%	33.45%	NA
All Japonica	1512	95.00%	5.00%	0.00%	0.07%	NA
Aus	269	92.60%	1.50%	0.00%	5.95%	NA
Indica I	595	38.00%	59.50%	0.17%	2.35%	NA
Indica II	465	42.60%	9.20%	0.65%	47.53%	NA
Indica III	913	28.50%	22.20%	1.20%	48.08%	NA
Indica Intermediate	786	33.30%	33.60%	1.40%	31.68%	NA
Temperate Japonica	767	98.20%	1.80%	0.00%	0.00%	NA
Tropical Japonica	504	88.90%	11.10%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	2.10%	0.00%	0.41%	NA
VI/Aromatic	96	27.10%	24.00%	2.08%	46.88%	NA
Intermediate	90	72.20%	12.20%	0.00%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0113550043	G -> A	LOC_Os01g24050.1	upstream_gene_variant ; 329.0bp to feature; MODIFIER	silent_mutation	Average:63.956; most accessible tissue: Callus, score: 95.016	N	N	N	N
vg0113550043	G -> A	LOC_Os01g24040.1	downstream_gene_variant ; 1264.0bp to feature; MODIFIER	silent_mutation	Average:63.956; most accessible tissue: Callus, score: 95.016	N	N	N	N
vg0113550043	G -> A	LOC_Os01g24040-LOC_Os01g24050	intergenic_region ; MODIFIER	silent_mutation	Average:63.956; most accessible tissue: Callus, score: 95.016	N	N	N	N
vg0113550043	G -> DEL	N	N	silent_mutation	Average:63.956; most accessible tissue: Callus, score: 95.016	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0113550043	NA	4.51E-09	mr1064	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550043	NA	2.59E-06	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550043	NA	7.86E-07	mr1236	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550043	NA	6.65E-07	mr1236	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550043	NA	9.63E-06	mr1280	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550043	NA	6.02E-06	mr1316	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550043	NA	2.44E-09	mr1534	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550043	NA	9.17E-06	mr1606	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550043	NA	1.52E-08	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550043	NA	1.71E-06	mr1654	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550043	NA	4.26E-06	mr1671	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550043	NA	8.83E-06	mr1741	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550043	NA	2.99E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550043	NA	2.76E-06	mr1968	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550043	NA	8.94E-06	mr1984	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550043	NA	4.66E-06	mr1322_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251