\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113550043:

Variant ID: vg0113550043 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13550043
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


CCTAGGATGGTGTCTATGGTATTAACTACATTGCCATGTAGGACTTTTAGCTTACGTAACACTATATTAATTAAGAGAGAGTGAAGAGAGGAGGAAACTG[G/A]
GTCTCATGCAAGACACAGCTTCAACACGAGAATCTATGCACTAGACACTATCAAGTTTTGCATTTGGAGAGAATAATGTTTTCATAATAGATGAAGAATA

Reverse complement sequence

TATTCTTCATCTATTATGAAAACATTATTCTCTCCAAATGCAAAACTTGATAGTGTCTAGTGCATAGATTCTCGTGTTGAAGCTGTGTCTTGCATGAGAC[C/T]
CAGTTTCCTCCTCTCTTCACTCTCTCTTAATTAATATAGTGTTACGTAAGCTAAAAGTCCTACATGGCAATGTAGTTAATACCATAGACACCATCCTAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.60% 20.70% 0.59% 21.14% NA
All Indica  2759 34.30% 31.30% 0.94% 33.45% NA
All Japonica  1512 95.00% 5.00% 0.00% 0.07% NA
Aus  269 92.60% 1.50% 0.00% 5.95% NA
Indica I  595 38.00% 59.50% 0.17% 2.35% NA
Indica II  465 42.60% 9.20% 0.65% 47.53% NA
Indica III  913 28.50% 22.20% 1.20% 48.08% NA
Indica Intermediate  786 33.30% 33.60% 1.40% 31.68% NA
Temperate Japonica  767 98.20% 1.80% 0.00% 0.00% NA
Tropical Japonica  504 88.90% 11.10% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.10% 0.00% 0.41% NA
VI/Aromatic  96 27.10% 24.00% 2.08% 46.88% NA
Intermediate  90 72.20% 12.20% 0.00% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113550043 G -> A LOC_Os01g24050.1 upstream_gene_variant ; 329.0bp to feature; MODIFIER silent_mutation Average:63.956; most accessible tissue: Callus, score: 95.016 N N N N
vg0113550043 G -> A LOC_Os01g24040.1 downstream_gene_variant ; 1264.0bp to feature; MODIFIER silent_mutation Average:63.956; most accessible tissue: Callus, score: 95.016 N N N N
vg0113550043 G -> A LOC_Os01g24040-LOC_Os01g24050 intergenic_region ; MODIFIER silent_mutation Average:63.956; most accessible tissue: Callus, score: 95.016 N N N N
vg0113550043 G -> DEL N N silent_mutation Average:63.956; most accessible tissue: Callus, score: 95.016 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113550043 NA 4.51E-09 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550043 NA 2.59E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550043 NA 7.86E-07 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550043 NA 6.65E-07 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550043 NA 9.63E-06 mr1280 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550043 NA 6.02E-06 mr1316 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550043 NA 2.44E-09 mr1534 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550043 NA 9.17E-06 mr1606 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550043 NA 1.52E-08 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550043 NA 1.71E-06 mr1654 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550043 NA 4.26E-06 mr1671 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550043 NA 8.83E-06 mr1741 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550043 NA 2.99E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550043 NA 2.76E-06 mr1968 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550043 NA 8.94E-06 mr1984 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550043 NA 4.66E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251