\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113458723:

Variant ID: vg0113458723 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13458723
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, C: 0.02, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


CTTGGTTTTGTGTGCACCATTAGCTTGAGAAGGCAACAATGCAAGTGCTGCTGTAGCAACGGCACTGGACCACCAGGCCCCAGGGCAGGCACGGGTGACT[C/A]
GGCTGTACACGCCAATGCACCTTTTCTTTCGTTTATTATTTTTTTTCATTTCACGATGAAACGTCCAGGCTCTTTCCTCCAAATGGACACGTGGCGGATT

Reverse complement sequence

AATCCGCCACGTGTCCATTTGGAGGAAAGAGCCTGGACGTTTCATCGTGAAATGAAAAAAAATAATAAACGAAAGAAAAGGTGCATTGGCGTGTACAGCC[G/T]
AGTCACCCGTGCCTGCCCTGGGGCCTGGTGGTCCAGTGCCGTTGCTACAGCAGCACTTGCATTGTTGCCTTCTCAAGCTAATGGTGCACACAAAACCAAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.70% 29.20% 0.21% 34.96% NA
All Indica  2759 50.70% 2.60% 0.22% 46.54% NA
All Japonica  1512 13.80% 82.80% 0.07% 3.37% NA
Aus  269 3.00% 0.40% 0.00% 96.65% NA
Indica I  595 33.60% 3.50% 0.67% 62.18% NA
Indica II  465 84.70% 1.90% 0.22% 13.12% NA
Indica III  913 48.80% 2.80% 0.00% 48.30% NA
Indica Intermediate  786 45.50% 1.90% 0.13% 52.42% NA
Temperate Japonica  767 1.30% 97.00% 0.00% 1.69% NA
Tropical Japonica  504 35.70% 57.30% 0.20% 6.75% NA
Japonica Intermediate  241 7.50% 90.90% 0.00% 1.66% NA
VI/Aromatic  96 35.40% 18.80% 0.00% 45.83% NA
Intermediate  90 42.20% 40.00% 3.33% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113458723 C -> A LOC_Os01g23910.1 upstream_gene_variant ; 2836.0bp to feature; MODIFIER silent_mutation Average:61.865; most accessible tissue: Callus, score: 99.416 N N N N
vg0113458723 C -> A LOC_Os01g23920.1 downstream_gene_variant ; 856.0bp to feature; MODIFIER silent_mutation Average:61.865; most accessible tissue: Callus, score: 99.416 N N N N
vg0113458723 C -> A LOC_Os01g23930.1 downstream_gene_variant ; 2721.0bp to feature; MODIFIER silent_mutation Average:61.865; most accessible tissue: Callus, score: 99.416 N N N N
vg0113458723 C -> A LOC_Os01g23910-LOC_Os01g23920 intergenic_region ; MODIFIER silent_mutation Average:61.865; most accessible tissue: Callus, score: 99.416 N N N N
vg0113458723 C -> DEL N N silent_mutation Average:61.865; most accessible tissue: Callus, score: 99.416 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0113458723 C A -0.12 -0.1 -0.07 -0.09 -0.11 -0.11

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113458723 NA 5.15E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113458723 NA 2.96E-20 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113458723 NA 3.66E-11 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113458723 NA 3.63E-14 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113458723 NA 2.56E-10 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113458723 NA 5.76E-18 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113458723 NA 4.04E-17 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113458723 NA 2.42E-15 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113458723 NA 3.79E-09 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113458723 NA 1.73E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113458723 NA 5.92E-06 mr1990 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113458723 NA 2.78E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113458723 NA 4.33E-15 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113458723 NA 1.06E-06 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113458723 NA 3.78E-26 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113458723 NA 3.69E-25 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113458723 NA 8.21E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113458723 NA 4.12E-17 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113458723 NA 1.49E-07 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113458723 NA 9.23E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113458723 NA 3.37E-13 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113458723 1.58E-06 NA mr1815_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113458723 NA 5.97E-06 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113458723 NA 1.81E-07 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251