\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113339657:

Variant ID: vg0113339657 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 13339657
Reference Allele: ACGAlternative Allele: GCG,A
Primary Allele: GCGSecondary Allele: ACG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGGACGCAGCTGCCGCTGTCGTCAGAGAGGAACTGGGCACGGGGCGGTCGCTACCGAAGGGGGGTTGGGCGTGAGGCCGCCGTCGGAGGGGAGGGGCTC[ACG/GCG,A]
GGACCACTGCCAGATCTCGTCGTTGTTTTTGGGCTTGGGTAAAAGGAAGAAAAGGGACAACGTGGTCATTTGCGACTTATTGCCACGTCAGTTTGCTGAG

Reverse complement sequence

CTCAGCAAACTGACGTGGCAATAAGTCGCAAATGACCACGTTGTCCCTTTTCTTCCTTTTACCCAAGCCCAAAAACAACGACGAGATCTGGCAGTGGTCC[CGT/CGC,T]
GAGCCCCTCCCCTCCGACGGCGGCCTCACGCCCAACCCCCCTTCGGTAGCGACCGCCCCGTGCCCAGTTCCTCTCTGACGACAGCGGCAGCTGCGTCCCT

Allele Frequencies:

Populations Population SizeFrequency of GCG(primary allele) Frequency of ACG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.50% 26.90% 0.66% 0.00% A: 0.02%
All Indica  2759 94.70% 4.20% 1.05% 0.00% NA
All Japonica  1512 26.20% 73.70% 0.07% 0.00% NA
Aus  269 99.30% 0.40% 0.00% 0.00% A: 0.37%
Indica I  595 95.80% 1.80% 2.35% 0.00% NA
Indica II  465 97.80% 1.90% 0.22% 0.00% NA
Indica III  913 94.30% 5.60% 0.11% 0.00% NA
Indica Intermediate  786 92.60% 5.70% 1.65% 0.00% NA
Temperate Japonica  767 18.30% 81.60% 0.13% 0.00% NA
Tropical Japonica  504 43.30% 56.70% 0.00% 0.00% NA
Japonica Intermediate  241 15.80% 84.20% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 66.70% 32.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113339657 ACG -> A LOC_Os01g23705.1 upstream_gene_variant ; 2431.0bp to feature; MODIFIER silent_mutation Average:66.838; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0113339657 ACG -> A LOC_Os01g23700.1 downstream_gene_variant ; 617.0bp to feature; MODIFIER silent_mutation Average:66.838; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0113339657 ACG -> A LOC_Os01g23710.1 downstream_gene_variant ; 3221.0bp to feature; MODIFIER silent_mutation Average:66.838; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0113339657 ACG -> A LOC_Os01g23690-LOC_Os01g23700 intergenic_region ; MODIFIER silent_mutation Average:66.838; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0113339657 ACG -> GCG LOC_Os01g23705.1 upstream_gene_variant ; 2432.0bp to feature; MODIFIER silent_mutation Average:66.838; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0113339657 ACG -> GCG LOC_Os01g23700.1 downstream_gene_variant ; 618.0bp to feature; MODIFIER silent_mutation Average:66.838; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0113339657 ACG -> GCG LOC_Os01g23710.1 downstream_gene_variant ; 3222.0bp to feature; MODIFIER silent_mutation Average:66.838; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0113339657 ACG -> GCG LOC_Os01g23690-LOC_Os01g23700 intergenic_region ; MODIFIER silent_mutation Average:66.838; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113339657 NA 4.33E-14 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657 NA 4.82E-13 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657 NA 5.18E-06 mr1049 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657 NA 9.63E-14 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657 NA 4.42E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657 NA 3.28E-24 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657 NA 1.23E-12 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657 NA 2.43E-08 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657 NA 2.26E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657 NA 2.20E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657 1.74E-06 NA mr1412 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657 NA 4.24E-11 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657 NA 2.85E-11 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657 NA 2.31E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657 NA 1.07E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657 NA 2.29E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657 NA 2.63E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657 NA 4.65E-09 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657 NA 1.73E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657 NA 3.57E-08 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251