Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113339657:

Variant ID: vg0113339657 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 13339657
Reference Allele: ACG	Alternative Allele: GCG,A
Primary Allele: GCG	Secondary Allele: ACG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGGGACGCAGCTGCCGCTGTCGTCAGAGAGGAACTGGGCACGGGGCGGTCGCTACCGAAGGGGGGTTGGGCGTGAGGCCGCCGTCGGAGGGGAGGGGCTC[ACG/GCG,A]
GGACCACTGCCAGATCTCGTCGTTGTTTTTGGGCTTGGGTAAAAGGAAGAAAAGGGACAACGTGGTCATTTGCGACTTATTGCCACGTCAGTTTGCTGAG

Reverse complement sequence

CTCAGCAAACTGACGTGGCAATAAGTCGCAAATGACCACGTTGTCCCTTTTCTTCCTTTTACCCAAGCCCAAAAACAACGACGAGATCTGGCAGTGGTCC[CGT/CGC,T]
GAGCCCCTCCCCTCCGACGGCGGCCTCACGCCCAACCCCCCTTCGGTAGCGACCGCCCCGTGCCCAGTTCCTCTCTGACGACAGCGGCAGCTGCGTCCCT

Allele Frequencies:

Populations	Population Size	Frequency of GCG(primary allele)	Frequency of ACG(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.50%	26.90%	0.66%	0.00%	A: 0.02%
All Indica	2759	94.70%	4.20%	1.05%	0.00%	NA
All Japonica	1512	26.20%	73.70%	0.07%	0.00%	NA
Aus	269	99.30%	0.40%	0.00%	0.00%	A: 0.37%
Indica I	595	95.80%	1.80%	2.35%	0.00%	NA
Indica II	465	97.80%	1.90%	0.22%	0.00%	NA
Indica III	913	94.30%	5.60%	0.11%	0.00%	NA
Indica Intermediate	786	92.60%	5.70%	1.65%	0.00%	NA
Temperate Japonica	767	18.30%	81.60%	0.13%	0.00%	NA
Tropical Japonica	504	43.30%	56.70%	0.00%	0.00%	NA
Japonica Intermediate	241	15.80%	84.20%	0.00%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	66.70%	32.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0113339657	ACG -> A	LOC_Os01g23705.1	upstream_gene_variant ; 2431.0bp to feature; MODIFIER	silent_mutation	Average:66.838; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0113339657	ACG -> A	LOC_Os01g23700.1	downstream_gene_variant ; 617.0bp to feature; MODIFIER	silent_mutation	Average:66.838; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0113339657	ACG -> A	LOC_Os01g23710.1	downstream_gene_variant ; 3221.0bp to feature; MODIFIER	silent_mutation	Average:66.838; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0113339657	ACG -> A	LOC_Os01g23690-LOC_Os01g23700	intergenic_region ; MODIFIER	silent_mutation	Average:66.838; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0113339657	ACG -> GCG	LOC_Os01g23705.1	upstream_gene_variant ; 2432.0bp to feature; MODIFIER	silent_mutation	Average:66.838; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0113339657	ACG -> GCG	LOC_Os01g23700.1	downstream_gene_variant ; 618.0bp to feature; MODIFIER	silent_mutation	Average:66.838; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0113339657	ACG -> GCG	LOC_Os01g23710.1	downstream_gene_variant ; 3222.0bp to feature; MODIFIER	silent_mutation	Average:66.838; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0113339657	ACG -> GCG	LOC_Os01g23690-LOC_Os01g23700	intergenic_region ; MODIFIER	silent_mutation	Average:66.838; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0113339657	NA	4.33E-14	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657	NA	4.82E-13	mr1034	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657	NA	5.18E-06	mr1049	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657	NA	9.63E-14	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657	NA	4.42E-08	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657	NA	3.28E-24	mr1163	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657	NA	1.23E-12	mr1170	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657	NA	2.43E-08	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657	NA	2.26E-07	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657	NA	2.20E-06	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657	1.74E-06	NA	mr1412	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657	NA	4.24E-11	mr1471	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657	NA	2.85E-11	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657	NA	2.31E-10	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657	NA	1.07E-06	mr1704	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657	NA	2.29E-13	mr1740	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657	NA	2.63E-09	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657	NA	4.65E-09	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657	NA	1.73E-07	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113339657	NA	3.57E-08	mr1030_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251