\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113118316:

Variant ID: vg0113118316 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13118316
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCAGTCCAGCGATATGGACTTTGATTAGTGACTAATCATGTTGATGAGCAATTAACTAATCTATTATCTATTATTATATACTAAAAATACATTAAACTT[C/T]
CTATAAACACTTCTAAGCTGCCACATGTCTTTCTACAAACGCTCTTAATTTAACATGTGGCACTTTTAAATAAGGTGGACCCACCAATTTCTTTTATTTA

Reverse complement sequence

TAAATAAAAGAAATTGGTGGGTCCACCTTATTTAAAAGTGCCACATGTTAAATTAAGAGCGTTTGTAGAAAGACATGTGGCAGCTTAGAAGTGTTTATAG[G/A]
AAGTTTAATGTATTTTTAGTATATAATAATAGATAATAGATTAGTTAATTGCTCATCAACATGATTAGTCACTAATCAAAGTCCATATCGCTGGACTGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.40% 21.60% 0.85% 7.17% NA
All Indica  2759 62.80% 25.60% 0.80% 10.80% NA
All Japonica  1512 96.00% 1.10% 0.60% 2.38% NA
Aus  269 5.20% 91.80% 2.60% 0.37% NA
Indica I  595 56.10% 35.50% 0.17% 8.24% NA
Indica II  465 64.30% 25.80% 0.65% 9.25% NA
Indica III  913 65.90% 18.50% 0.99% 14.57% NA
Indica Intermediate  786 63.50% 26.10% 1.15% 9.29% NA
Temperate Japonica  767 97.70% 0.40% 0.52% 1.43% NA
Tropical Japonica  504 93.80% 1.00% 0.60% 4.56% NA
Japonica Intermediate  241 95.00% 3.30% 0.83% 0.83% NA
VI/Aromatic  96 65.60% 32.30% 2.08% 0.00% NA
Intermediate  90 72.20% 23.30% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113118316 C -> T LOC_Os01g23340.1 upstream_gene_variant ; 2357.0bp to feature; MODIFIER silent_mutation Average:80.451; most accessible tissue: Callus, score: 91.472 N N N N
vg0113118316 C -> T LOC_Os01g23340-LOC_Os01g23350 intergenic_region ; MODIFIER silent_mutation Average:80.451; most accessible tissue: Callus, score: 91.472 N N N N
vg0113118316 C -> DEL N N silent_mutation Average:80.451; most accessible tissue: Callus, score: 91.472 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113118316 NA 4.91E-07 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113118316 NA 5.28E-07 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113118316 NA 1.62E-08 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113118316 NA 8.65E-06 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113118316 NA 3.66E-09 mr1654 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113118316 NA 5.22E-07 mr1654 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113118316 NA 1.51E-18 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113118316 NA 3.59E-07 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113118316 NA 4.85E-06 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113118316 NA 6.82E-14 mr1193_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113118316 NA 1.56E-07 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113118316 NA 1.23E-10 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113118316 NA 4.14E-07 mr1654_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113118316 NA 4.15E-23 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113118316 NA 2.27E-06 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251