\
| Variant ID: vg0113118316 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 13118316 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTCAGTCCAGCGATATGGACTTTGATTAGTGACTAATCATGTTGATGAGCAATTAACTAATCTATTATCTATTATTATATACTAAAAATACATTAAACTT[C/T]
CTATAAACACTTCTAAGCTGCCACATGTCTTTCTACAAACGCTCTTAATTTAACATGTGGCACTTTTAAATAAGGTGGACCCACCAATTTCTTTTATTTA
TAAATAAAAGAAATTGGTGGGTCCACCTTATTTAAAAGTGCCACATGTTAAATTAAGAGCGTTTGTAGAAAGACATGTGGCAGCTTAGAAGTGTTTATAG[G/A]
AAGTTTAATGTATTTTTAGTATATAATAATAGATAATAGATTAGTTAATTGCTCATCAACATGATTAGTCACTAATCAAAGTCCATATCGCTGGACTGAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.40% | 21.60% | 0.85% | 7.17% | NA |
| All Indica | 2759 | 62.80% | 25.60% | 0.80% | 10.80% | NA |
| All Japonica | 1512 | 96.00% | 1.10% | 0.60% | 2.38% | NA |
| Aus | 269 | 5.20% | 91.80% | 2.60% | 0.37% | NA |
| Indica I | 595 | 56.10% | 35.50% | 0.17% | 8.24% | NA |
| Indica II | 465 | 64.30% | 25.80% | 0.65% | 9.25% | NA |
| Indica III | 913 | 65.90% | 18.50% | 0.99% | 14.57% | NA |
| Indica Intermediate | 786 | 63.50% | 26.10% | 1.15% | 9.29% | NA |
| Temperate Japonica | 767 | 97.70% | 0.40% | 0.52% | 1.43% | NA |
| Tropical Japonica | 504 | 93.80% | 1.00% | 0.60% | 4.56% | NA |
| Japonica Intermediate | 241 | 95.00% | 3.30% | 0.83% | 0.83% | NA |
| VI/Aromatic | 96 | 65.60% | 32.30% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 23.30% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0113118316 | C -> T | LOC_Os01g23340.1 | upstream_gene_variant ; 2357.0bp to feature; MODIFIER | silent_mutation | Average:80.451; most accessible tissue: Callus, score: 91.472 | N | N | N | N |
| vg0113118316 | C -> T | LOC_Os01g23340-LOC_Os01g23350 | intergenic_region ; MODIFIER | silent_mutation | Average:80.451; most accessible tissue: Callus, score: 91.472 | N | N | N | N |
| vg0113118316 | C -> DEL | N | N | silent_mutation | Average:80.451; most accessible tissue: Callus, score: 91.472 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0113118316 | NA | 4.91E-07 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113118316 | NA | 5.28E-07 | mr1193 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113118316 | NA | 1.62E-08 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113118316 | NA | 8.65E-06 | mr1386 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113118316 | NA | 3.66E-09 | mr1654 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113118316 | NA | 5.22E-07 | mr1654 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113118316 | NA | 1.51E-18 | mr1855 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113118316 | NA | 3.59E-07 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113118316 | NA | 4.85E-06 | mr1128_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113118316 | NA | 6.82E-14 | mr1193_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113118316 | NA | 1.56E-07 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113118316 | NA | 1.23E-10 | mr1654_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113118316 | NA | 4.14E-07 | mr1654_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113118316 | NA | 4.15E-23 | mr1855_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113118316 | NA | 2.27E-06 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |