\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113100532:

Variant ID: vg0113100532 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13100532
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTGACAGGCGGGCCCCACCTGTCAGCGTCCGAGGGCGCGCGCACGTGGCTGCTGCGGGCGGACTGGGCCGGCTTGGGCCGGGGAGAGAGAGAAGGTTTT[G/A]
GGCCGACTTTCGGCCCAAAGCCAAAAGAGGATTTTAAAAACCTTTTTTAATTTAAATTATTCATTAAATGTAATTCCATTTATTAAAAATACTTCCTTAG

Reverse complement sequence

CTAAGGAAGTATTTTTAATAAATGGAATTACATTTAATGAATAATTTAAATTAAAAAAGGTTTTTAAAATCCTCTTTTGGCTTTGGGCCGAAAGTCGGCC[C/T]
AAAACCTTCTCTCTCTCCCCGGCCCAAGCCGGCCCAGTCCGCCCGCAGCAGCCACGTGCGCGCGCCCTCGGACGCTGACAGGTGGGGCCCGCCTGTCAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.70% 3.20% 1.50% 7.60% NA
All Indica  2759 89.70% 0.00% 0.87% 9.39% NA
All Japonica  1512 81.10% 9.70% 3.04% 6.22% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 91.60% 0.00% 0.67% 7.73% NA
Indica II  465 90.80% 0.00% 1.08% 8.17% NA
Indica III  913 86.30% 0.00% 0.99% 12.71% NA
Indica Intermediate  786 91.70% 0.00% 0.76% 7.51% NA
Temperate Japonica  767 86.80% 1.00% 3.52% 8.60% NA
Tropical Japonica  504 66.50% 26.60% 2.18% 4.76% NA
Japonica Intermediate  241 93.40% 1.70% 3.32% 1.66% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 3.30% 1.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113100532 G -> A LOC_Os01g23320.1 upstream_gene_variant ; 2581.0bp to feature; MODIFIER silent_mutation Average:44.221; most accessible tissue: Minghui63 young leaf, score: 67.374 N N N N
vg0113100532 G -> A LOC_Os01g23330.1 downstream_gene_variant ; 1559.0bp to feature; MODIFIER silent_mutation Average:44.221; most accessible tissue: Minghui63 young leaf, score: 67.374 N N N N
vg0113100532 G -> A LOC_Os01g23320-LOC_Os01g23330 intergenic_region ; MODIFIER silent_mutation Average:44.221; most accessible tissue: Minghui63 young leaf, score: 67.374 N N N N
vg0113100532 G -> DEL N N silent_mutation Average:44.221; most accessible tissue: Minghui63 young leaf, score: 67.374 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113100532 NA 4.97E-07 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113100532 NA 1.44E-08 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113100532 9.38E-08 1.87E-11 mr1083 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113100532 NA 3.98E-07 mr1107 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113100532 7.90E-06 2.16E-07 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113100532 NA 3.91E-06 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113100532 NA 2.94E-06 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113100532 NA 5.57E-06 mr1878 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113100532 NA 6.12E-07 mr1949 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113100532 4.28E-08 4.28E-08 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113100532 3.36E-06 2.86E-10 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113100532 9.04E-06 2.80E-09 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113100532 NA 2.68E-06 mr1103_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113100532 1.20E-06 2.85E-07 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113100532 8.74E-06 1.66E-07 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113100532 NA 3.65E-08 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113100532 5.13E-07 5.13E-07 mr1264_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113100532 NA 5.62E-06 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251