Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0112795017:

Variant ID: vg0112795017 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 12795017
Reference Allele: CT	Alternative Allele: TT,C
Primary Allele: CT	Secondary Allele: TT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCCCCCTTACAAGAATCTCGTCCCCGAGATTCGAGGAGGCTAGCAAGAAGATAGGTTGGGCGGTCTTCTCTTCTTGTCTGACTTCTTCCGCTCCGTCTT[CT/TT,C]
TATAACAAACTTGCCTAGCACAACTTCTCCACTCTGGACTGCTTGGCTCGATCTCCTGTTGCAGATGGAATCTTCTCTTCACCTGACTTGTCCCTGGTTG

Reverse complement sequence

CAACCAGGGACAAGTCAGGTGAAGAGAAGATTCCATCTGCAACAGGAGATCGAGCCAAGCAGTCCAGAGTGGAGAAGTTGTGCTAGGCAAGTTTGTTATA[AG/AA,G]
AAGACGGAGCGGAAGAAGTCAGACAAGAAGAGAAGACCGCCCAACCTATCTTCTTGCTAGCCTCCTCGAATCTCGGGGACGAGATTCTTGTAAGGGGGGT

Allele Frequencies:

Populations	Population Size	Frequency of CT(primary allele)	Frequency of TT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	26.80%	0.30%	4.93%	67.96%	C: 0.02%
All Indica	2759	2.00%	0.20%	2.28%	95.58%	NA
All Japonica	1512	77.60%	0.10%	8.53%	13.76%	C: 0.07%
Aus	269	0.00%	2.20%	1.12%	96.65%	NA
Indica I	595	1.00%	0.00%	2.86%	96.13%	NA
Indica II	465	3.20%	0.90%	1.51%	94.41%	NA
Indica III	913	1.60%	0.00%	2.85%	95.51%	NA
Indica Intermediate	786	2.30%	0.10%	1.65%	95.93%	NA
Temperate Japonica	767	74.40%	0.10%	10.56%	14.73%	C: 0.13%
Tropical Japonica	504	74.80%	0.00%	8.33%	16.87%	NA
Japonica Intermediate	241	93.40%	0.00%	2.49%	4.15%	NA
VI/Aromatic	96	6.20%	0.00%	31.25%	62.50%	NA
Intermediate	90	37.80%	1.10%	8.89%	52.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0112795017	CT -> TT	LOC_Os01g22750.1	upstream_gene_variant ; 3322.0bp to feature; MODIFIER	silent_mutation	Average:6.713; most accessible tissue: Callus, score: 17.257	N	N	N	N
vg0112795017	CT -> TT	LOC_Os01g22760.1	downstream_gene_variant ; 2178.0bp to feature; MODIFIER	silent_mutation	Average:6.713; most accessible tissue: Callus, score: 17.257	N	N	N	N
vg0112795017	CT -> TT	LOC_Os01g22750-LOC_Os01g22760	intergenic_region ; MODIFIER	silent_mutation	Average:6.713; most accessible tissue: Callus, score: 17.257	N	N	N	N
vg0112795017	CT -> DEL	N	N	silent_mutation	Average:6.713; most accessible tissue: Callus, score: 17.257	N	N	N	N
vg0112795017	CT -> C	LOC_Os01g22750.1	upstream_gene_variant ; 3323.0bp to feature; MODIFIER	silent_mutation	Average:6.713; most accessible tissue: Callus, score: 17.257	N	N	N	N
vg0112795017	CT -> C	LOC_Os01g22760.1	downstream_gene_variant ; 2177.0bp to feature; MODIFIER	silent_mutation	Average:6.713; most accessible tissue: Callus, score: 17.257	N	N	N	N
vg0112795017	CT -> C	LOC_Os01g22750-LOC_Os01g22760	intergenic_region ; MODIFIER	silent_mutation	Average:6.713; most accessible tissue: Callus, score: 17.257	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0112795017	3.45E-06	1.10E-21	mr1498	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112795017	NA	1.24E-19	mr1769	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112795017	NA	1.63E-08	mr1925	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112795017	3.42E-08	5.27E-18	mr1951	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112795017	NA	6.43E-08	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112795017	NA	9.90E-15	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112795017	NA	4.64E-19	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112795017	NA	9.65E-09	mr1925_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112795017	NA	2.73E-12	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251