\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112763835:

Variant ID: vg0112763835 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 12763835
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, T: 0.04, A: 0.01, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


TCAGCTATTTTTAAATCGTATTTTTACTTGGACTCTCCTTTTCTTTTCTAATTTTGTATTTTTTTATTTTTATTTCGAATTTTGATTAATCTCATACTGT[G/T]
TTCTTATATGGAAACTTCTTTCAATATTACTTATTTTTAATTTCGAATTTCAGCTATTTTTAAATCGTATTTCTACTTGGACTCTCCTTTTCTTTTTTTT

Reverse complement sequence

AAAAAAAAGAAAAGGAGAGTCCAAGTAGAAATACGATTTAAAAATAGCTGAAATTCGAAATTAAAAATAAGTAATATTGAAAGAAGTTTCCATATAAGAA[C/A]
ACAGTATGAGATTAATCAAAATTCGAAATAAAAATAAAAAAATACAAAATTAGAAAAGAAAAGGAGAGTCCAAGTAAAAATACGATTTAAAAATAGCTGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.20% 34.70% 1.52% 0.57% NA
All Indica  2759 91.60% 4.80% 2.57% 0.98% NA
All Japonica  1512 3.60% 96.40% 0.07% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 98.80% 0.70% 0.50% 0.00% NA
Indica II  465 75.90% 15.10% 5.38% 3.66% NA
Indica III  913 94.00% 3.20% 2.85% 0.00% NA
Indica Intermediate  786 92.70% 3.80% 2.16% 1.27% NA
Temperate Japonica  767 1.30% 98.60% 0.13% 0.00% NA
Tropical Japonica  504 6.50% 93.50% 0.00% 0.00% NA
Japonica Intermediate  241 4.60% 95.40% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 53.30% 46.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0112763835 G -> T LOC_Os01g22720.1 upstream_gene_variant ; 1517.0bp to feature; MODIFIER silent_mutation Average:21.439; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0112763835 G -> T LOC_Os01g22710.1 downstream_gene_variant ; 3692.0bp to feature; MODIFIER silent_mutation Average:21.439; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0112763835 G -> T LOC_Os01g22710-LOC_Os01g22720 intergenic_region ; MODIFIER silent_mutation Average:21.439; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0112763835 G -> DEL N N silent_mutation Average:21.439; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0112763835 NA 4.82E-09 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0112763835 NA 5.27E-12 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112763835 NA 8.04E-24 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112763835 NA 4.44E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112763835 NA 1.05E-25 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112763835 NA 5.29E-11 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112763835 NA 1.42E-10 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112763835 NA 2.69E-07 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112763835 NA 2.28E-08 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112763835 NA 3.18E-09 mr1332_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112763835 NA 2.41E-07 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112763835 NA 3.02E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112763835 NA 8.73E-06 mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112763835 NA 1.09E-23 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112763835 NA 8.75E-06 mr1579_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112763835 NA 6.95E-08 mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112763835 NA 5.60E-08 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112763835 NA 9.70E-06 mr1654_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112763835 NA 4.19E-17 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112763835 NA 4.95E-12 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112763835 NA 1.84E-09 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112763835 NA 1.84E-09 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112763835 NA 1.47E-10 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251