\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112709868:

Variant ID: vg0112709868 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 12709868
Reference Allele: TAlternative Allele: TCGG,G
Primary Allele: TCGGSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGAAATTTGATGGCGAGAAAATAATAAAAATAAAAAATGATAAAAATAATCGAGAGCGTTGCCTAGTCATCTAGGGGTTGGGAAGTTTCCAGCGTGGTCG[T/TCGG,G]
GGTCGGGGTCGGCGCGGCCCCCGCGCTTGCCTACCTCCCACGACTCGGGGGTGTTTAGATGGGAGTAAAACTTTTTAGCCCATGTCACATCGGATGTTTA

Reverse complement sequence

TAAACATCCGATGTGACATGGGCTAAAAAGTTTTACTCCCATCTAAACACCCCCGAGTCGTGGGAGGTAGGCAAGCGCGGGGGCCGCGCCGACCCCGACC[A/CCGA,C]
CGACCACGCTGGAAACTTCCCAACCCCTAGATGACTAGGCAACGCTCTCGATTATTTTTATCATTTTTTATTTTTATTATTTTCTCGCCATCAAATTTCC

Allele Frequencies:

Populations Population SizeFrequency of TCGG(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.20% 30.70% 1.95% 0.17% G: 4.00%
All Indica  2759 90.40% 1.20% 2.32% 0.25% G: 5.76%
All Japonica  1512 11.10% 87.70% 0.93% 0.07% G: 0.20%
Aus  269 90.30% 0.70% 1.12% 0.00% G: 7.81%
Indica I  595 95.60% 0.70% 0.50% 0.00% G: 3.19%
Indica II  465 88.20% 3.00% 1.29% 0.22% G: 7.31%
Indica III  913 88.20% 0.20% 3.94% 0.66% G: 7.01%
Indica Intermediate  786 90.50% 1.80% 2.42% 0.00% G: 5.34%
Temperate Japonica  767 5.00% 94.50% 0.39% 0.00% G: 0.13%
Tropical Japonica  504 18.10% 80.00% 1.39% 0.20% G: 0.40%
Japonica Intermediate  241 16.20% 82.20% 1.66% 0.00% NA
VI/Aromatic  96 33.30% 54.20% 7.29% 0.00% G: 5.21%
Intermediate  90 52.20% 42.20% 4.44% 0.00% G: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0112709868 T -> G LOC_Os01g22600.1 upstream_gene_variant ; 60.0bp to feature; MODIFIER silent_mutation Average:99.481; most accessible tissue: Zhenshan97 flag leaf, score: 99.82 N N N N
vg0112709868 T -> G LOC_Os01g22600-LOC_Os01g22620 intergenic_region ; MODIFIER silent_mutation Average:99.481; most accessible tissue: Zhenshan97 flag leaf, score: 99.82 N N N N
vg0112709868 T -> DEL N N silent_mutation Average:99.481; most accessible tissue: Zhenshan97 flag leaf, score: 99.82 N N N N
vg0112709868 T -> TCGG LOC_Os01g22600.1 upstream_gene_variant ; 61.0bp to feature; MODIFIER silent_mutation Average:99.481; most accessible tissue: Zhenshan97 flag leaf, score: 99.82 N N N N
vg0112709868 T -> TCGG LOC_Os01g22600-LOC_Os01g22620 intergenic_region ; MODIFIER silent_mutation Average:99.481; most accessible tissue: Zhenshan97 flag leaf, score: 99.82 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0112709868 T G -0.03 -0.04 -0.05 -0.01 -0.03 -0.02
vg0112709868 T TCGG -0.07 -0.05 -0.05 -0.06 -0.04 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0112709868 NA 7.59E-06 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112709868 NA 5.88E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112709868 NA 1.83E-14 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112709868 NA 6.28E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112709868 NA 4.44E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112709868 NA 5.57E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112709868 NA 6.77E-27 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112709868 NA 2.86E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112709868 NA 3.64E-11 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112709868 NA 4.39E-06 mr1986 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251