Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0112449854:

Variant ID: vg0112449854 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 12449854
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:

AAATTGATAATAGAGTACAAATATTACTCTAATTAATAAGCGAATAAACTGTCATTATAGAGGTAGATAGTTCCTCTCAATCAATAAAGATCTAAGCAGC[G/A]
GAAAATAAATAAACGGCGCAGACGGCTCCACTCCACAGGCAGCTTGACCAAGGCTACACCTAATCCTCCACACCATCAGCCTCATTGTAGAACTCTTCCT

Reverse complement sequence

AGGAAGAGTTCTACAATGAGGCTGATGGTGTGGAGGATTAGGTGTAGCCTTGGTCAAGCTGCCTGTGGAGTGGAGCCGTCTGCGCCGTTTATTTATTTTC[C/T]
GCTGCTTAGATCTTTATTGATTGAGAGGAACTATCTACCTCTATAATGACAGTTTATTCGCTTATTAATTAGAGTAATATTTGTACTCTATTATCAATTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	29.70%	2.00%	12.38%	55.97%	NA
All Indica	2759	4.70%	0.00%	13.19%	82.09%	NA
All Japonica	1512	76.90%	6.00%	5.69%	11.38%	NA
Aus	269	1.10%	0.00%	45.72%	53.16%	NA
Indica I	595	3.20%	0.00%	1.68%	95.13%	NA
Indica II	465	5.80%	0.00%	4.73%	89.46%	NA
Indica III	913	4.80%	0.00%	23.11%	72.07%	NA
Indica Intermediate	786	5.00%	0.10%	15.39%	79.52%	NA
Temperate Japonica	767	79.00%	11.90%	3.78%	5.35%	NA
Tropical Japonica	504	81.00%	0.00%	5.56%	13.49%	NA
Japonica Intermediate	241	61.80%	0.00%	12.03%	26.14%	NA
VI/Aromatic	96	68.80%	0.00%	0.00%	31.25%	NA
Intermediate	90	46.70%	1.10%	13.33%	38.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0112449854	G -> A	LOC_Os01g22150.1	upstream_gene_variant ; 3704.0bp to feature; MODIFIER	silent_mutation	Average:6.05; most accessible tissue: Minghui63 young leaf, score: 9.976	N	N	N	N
vg0112449854	G -> A	LOC_Os01g22150-LOC_Os01g22170	intergenic_region ; MODIFIER	silent_mutation	Average:6.05; most accessible tissue: Minghui63 young leaf, score: 9.976	N	N	N	N
vg0112449854	G -> DEL	N	N	silent_mutation	Average:6.05; most accessible tissue: Minghui63 young leaf, score: 9.976	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0112449854	4.72E-07	NA	mr1648	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112449854	NA	3.63E-09	mr1648	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112449854	NA	8.54E-07	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112449854	NA	1.38E-09	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251