\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112338981:

Variant ID: vg0112338981 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 12338981
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


AAGCACGCTGAACGGGAGGAGGCCCGCGCGCGCCAGCTAAATTGTTGGCGCTTACGCGTGCATTAGCCTCCCCCGACAAACCCAATCTGGATCCTAAGAG[T/G]
CCGACATGAGGGATCTAGAGTTACCTCCAATTTCATTGAGTTCATGTTTGAGAAATAAGACTACACTATCCGTCGACTACGTGAGAAAGCTCCATGCCGC

Reverse complement sequence

GCGGCATGGAGCTTTCTCACGTAGTCGACGGATAGTGTAGTCTTATTTCTCAAACATGAACTCAATGAAATTGGAGGTAACTCTAGATCCCTCATGTCGG[A/C]
CTCTTAGGATCCAGATTGGGTTTGTCGGGGGAGGCTAATGCACGCGTAAGCGCCAACAATTTAGCTGGCGCGCGCGGGCCTCCTCCCGTTCAGCGTGCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.00% 9.20% 1.82% 0.00% NA
All Indica  2759 99.70% 0.30% 0.00% 0.00% NA
All Japonica  1512 66.80% 27.60% 5.56% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 53.30% 38.50% 8.21% 0.00% NA
Tropical Japonica  504 81.00% 17.10% 1.98% 0.00% NA
Japonica Intermediate  241 80.10% 15.40% 4.56% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0112338981 T -> G LOC_Os01g21970.1 upstream_gene_variant ; 1754.0bp to feature; MODIFIER silent_mutation Average:46.524; most accessible tissue: Zhenshan97 young leaf, score: 56.533 N N N N
vg0112338981 T -> G LOC_Os01g21980.1 downstream_gene_variant ; 808.0bp to feature; MODIFIER silent_mutation Average:46.524; most accessible tissue: Zhenshan97 young leaf, score: 56.533 N N N N
vg0112338981 T -> G LOC_Os01g21970-LOC_Os01g21980 intergenic_region ; MODIFIER silent_mutation Average:46.524; most accessible tissue: Zhenshan97 young leaf, score: 56.533 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0112338981 NA 9.71E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112338981 NA 2.67E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112338981 NA 2.41E-06 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112338981 NA 3.28E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112338981 NA 1.55E-06 mr1622 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112338981 7.51E-06 NA mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112338981 NA 2.69E-06 mr1960 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112338981 4.19E-06 2.07E-07 mr1991 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112338981 7.43E-06 NA mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251