\
| Variant ID: vg0112338981 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 12338981 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 117. )
AAGCACGCTGAACGGGAGGAGGCCCGCGCGCGCCAGCTAAATTGTTGGCGCTTACGCGTGCATTAGCCTCCCCCGACAAACCCAATCTGGATCCTAAGAG[T/G]
CCGACATGAGGGATCTAGAGTTACCTCCAATTTCATTGAGTTCATGTTTGAGAAATAAGACTACACTATCCGTCGACTACGTGAGAAAGCTCCATGCCGC
GCGGCATGGAGCTTTCTCACGTAGTCGACGGATAGTGTAGTCTTATTTCTCAAACATGAACTCAATGAAATTGGAGGTAACTCTAGATCCCTCATGTCGG[A/C]
CTCTTAGGATCCAGATTGGGTTTGTCGGGGGAGGCTAATGCACGCGTAAGCGCCAACAATTTAGCTGGCGCGCGCGGGCCTCCTCCCGTTCAGCGTGCTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.00% | 9.20% | 1.82% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 66.80% | 27.60% | 5.56% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 53.30% | 38.50% | 8.21% | 0.00% | NA |
| Tropical Japonica | 504 | 81.00% | 17.10% | 1.98% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.10% | 15.40% | 4.56% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 7.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0112338981 | T -> G | LOC_Os01g21970.1 | upstream_gene_variant ; 1754.0bp to feature; MODIFIER | silent_mutation | Average:46.524; most accessible tissue: Zhenshan97 young leaf, score: 56.533 | N | N | N | N |
| vg0112338981 | T -> G | LOC_Os01g21980.1 | downstream_gene_variant ; 808.0bp to feature; MODIFIER | silent_mutation | Average:46.524; most accessible tissue: Zhenshan97 young leaf, score: 56.533 | N | N | N | N |
| vg0112338981 | T -> G | LOC_Os01g21970-LOC_Os01g21980 | intergenic_region ; MODIFIER | silent_mutation | Average:46.524; most accessible tissue: Zhenshan97 young leaf, score: 56.533 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0112338981 | NA | 9.71E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112338981 | NA | 2.67E-07 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112338981 | NA | 2.41E-06 | mr1373 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112338981 | NA | 3.28E-06 | mr1418 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112338981 | NA | 1.55E-06 | mr1622 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112338981 | 7.51E-06 | NA | mr1745 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112338981 | NA | 2.69E-06 | mr1960 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112338981 | 4.19E-06 | 2.07E-07 | mr1991 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112338981 | 7.43E-06 | NA | mr1745_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |