\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112316430:

Variant ID: vg0112316430 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 12316430
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.08, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TATTATAGTATTTTAAAAGACAAATCTATACATGTTGTTTTAGTTCCTTTTAAACTAAATATTTTAAAAGTTATTGATGGTCAAAGTTATAAAAGTTTGA[T/C]
CTTAACCTTGTCCAAAACGTCAATTAATATGAAACCGGAGGGAGTAATATAGTTTTAATGTAACTGCAATATAACTACATTATTTATATAGTATAATTAT

Reverse complement sequence

ATAATTATACTATATAAATAATGTAGTTATATTGCAGTTACATTAAAACTATATTACTCCCTCCGGTTTCATATTAATTGACGTTTTGGACAAGGTTAAG[A/G]
TCAAACTTTTATAACTTTGACCATCAATAACTTTTAAAATATTTAGTTTAAAAGGAACTAAAACAACATGTATAGATTTGTCTTTTAAAATACTATAATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.10% 28.40% 4.61% 4.87% NA
All Indica  2759 88.10% 4.60% 2.46% 4.89% NA
All Japonica  1512 10.60% 74.50% 9.59% 5.36% NA
Aus  269 97.00% 0.70% 0.37% 1.86% NA
Indica I  595 93.60% 0.50% 2.86% 3.03% NA
Indica II  465 76.60% 6.70% 6.45% 10.32% NA
Indica III  913 91.30% 6.10% 0.44% 2.08% NA
Indica Intermediate  786 86.90% 4.60% 2.16% 6.36% NA
Temperate Japonica  767 2.70% 75.20% 15.38% 6.65% NA
Tropical Japonica  504 19.20% 71.20% 4.56% 4.96% NA
Japonica Intermediate  241 17.40% 78.80% 1.66% 2.07% NA
VI/Aromatic  96 36.50% 58.30% 1.04% 4.17% NA
Intermediate  90 55.60% 35.60% 3.33% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0112316430 T -> DEL N N silent_mutation Average:31.708; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0112316430 T -> C LOC_Os01g21950.1 upstream_gene_variant ; 345.0bp to feature; MODIFIER silent_mutation Average:31.708; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0112316430 T -> C LOC_Os01g21940-LOC_Os01g21950 intergenic_region ; MODIFIER silent_mutation Average:31.708; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0112316430 NA 3.39E-99 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112316430 NA 3.91E-13 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112316430 NA 2.84E-69 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112316430 NA 1.14E-09 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112316430 NA 1.55E-17 mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112316430 NA 2.78E-17 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112316430 NA 5.36E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112316430 NA 2.10E-21 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112316430 NA 4.84E-21 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112316430 NA 3.01E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112316430 NA 3.85E-35 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112316430 NA 6.63E-61 mr1695 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112316430 NA 1.38E-20 mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112316430 NA 6.81E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112316430 NA 7.78E-69 mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112316430 NA 4.69E-53 mr1889 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112316430 NA 1.48E-25 mr1903 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112316430 NA 9.15E-25 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112316430 NA 9.07E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112316430 NA 1.39E-16 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251