Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112097431:

Variant ID: vg0112097431 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 12097431
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.02, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:

CAGAATATAAGGATTTTTAAGGTTGCATACGGGTATTAAATAGGAGAAAATATGTAGAATTAAATCGGAGAAGGTTATTGACGGAGCGTGGGGCTCCTCA[C/T]
CGGGAGACCGCGCAGGCCCCCCTTTGCCGGTTCGGCCGGGGGCCCTGGGTGAGATTCTAAGCTCCTAGTCTGTGTGTGAAAGGTTCGCGAGAGTGGAAAC

Reverse complement sequence

GTTTCCACTCTCGCGAACCTTTCACACACAGACTAGGAGCTTAGAATCTCACCCAGGGCCCCCGGCCGAACCGGCAAAGGGGGGCCTGCGCGGTCTCCCG[G/A]
TGAGGAGCCCCACGCTCCGTCAATAACCTTCTCCGATTTAATTCTACATATTTTCTCCTATTTAATACCCGTATGCAACCTTAAAAATCCTTATATTCTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	27.40%	5.30%	0.72%	66.57%	NA
All Indica	2759	1.90%	0.20%	0.76%	97.10%	NA
All Japonica	1512	78.20%	15.70%	0.60%	5.49%	NA
Aus	269	1.50%	0.00%	1.49%	97.03%	NA
Indica I	595	1.50%	0.00%	0.67%	97.82%	NA
Indica II	465	2.80%	0.90%	0.22%	96.13%	NA
Indica III	913	0.90%	0.10%	0.44%	98.58%	NA
Indica Intermediate	786	2.90%	0.10%	1.53%	95.42%	NA
Temperate Japonica	767	95.70%	2.00%	0.78%	1.56%	NA
Tropical Japonica	504	45.80%	40.70%	0.40%	13.10%	NA
Japonica Intermediate	241	90.00%	7.50%	0.41%	2.07%	NA
VI/Aromatic	96	22.90%	1.00%	0.00%	76.04%	NA
Intermediate	90	37.80%	6.70%	0.00%	55.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0112097431	C -> T	LOC_Os01g21600.1	upstream_gene_variant ; 1560.0bp to feature; MODIFIER	silent_mutation	Average:67.581; most accessible tissue: Minghui63 panicle, score: 88.281	N	N	N	N
vg0112097431	C -> T	LOC_Os01g21590.1	downstream_gene_variant ; 4155.0bp to feature; MODIFIER	silent_mutation	Average:67.581; most accessible tissue: Minghui63 panicle, score: 88.281	N	N	N	N
vg0112097431	C -> T	LOC_Os01g21590-LOC_Os01g21600	intergenic_region ; MODIFIER	silent_mutation	Average:67.581; most accessible tissue: Minghui63 panicle, score: 88.281	N	N	N	N
vg0112097431	C -> DEL	N	N	silent_mutation	Average:67.581; most accessible tissue: Minghui63 panicle, score: 88.281	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0112097431	NA	2.27E-06	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112097431	NA	1.24E-07	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112097431	NA	6.17E-08	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112097431	NA	3.30E-07	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112097431	1.01E-07	1.01E-07	mr1076_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112097431	5.86E-06	3.71E-10	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112097431	NA	7.25E-08	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112097431	NA	2.17E-06	mr1103_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112097431	NA	1.49E-06	mr1107_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112097431	6.05E-08	NA	mr1155_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112097431	NA	1.41E-08	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112097431	7.11E-06	6.06E-08	mr1408_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251