\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0111937827:

Variant ID: vg0111937827 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 11937827
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.12, A: 0.01, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


TGTCAATGTTTAGCAATCCTAGGGTGATATGATCTCAAGTATGTCTCTAGAAATGTAAATTGCACAAATGTAAATGCGACAATCAAATGAGACAAGAAGA[T/C]
AAGAGATTTTTCACCGAGGTTCGGAAACTCGCCGGTTTCCTACTCCCCGTTGAGGCGAGCCCAACTCCACCGCTCAACCACGAAGCCACCGCACGCCCCC

Reverse complement sequence

GGGGGCGTGCGGTGGCTTCGTGGTTGAGCGGTGGAGTTGGGCTCGCCTCAACGGGGAGTAGGAAACCGGCGAGTTTCCGAACCTCGGTGAAAAATCTCTT[A/G]
TCTTCTTGTCTCATTTGATTGTCGCATTTACATTTGTGCAATTTACATTTCTAGAGACATACTTGAGATCATATCACCCTAGGATTGCTAAACATTGACA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.80% 11.90% 23.47% 39.84% NA
All Indica  2759 4.60% 3.40% 33.13% 58.86% NA
All Japonica  1512 65.10% 29.80% 2.91% 2.25% NA
Aus  269 1.10% 1.90% 44.98% 52.04% NA
Indica I  595 1.70% 2.90% 31.60% 63.87% NA
Indica II  465 3.90% 4.70% 26.02% 65.38% NA
Indica III  913 6.20% 3.00% 35.05% 55.75% NA
Indica Intermediate  786 5.20% 3.70% 36.26% 54.83% NA
Temperate Japonica  767 71.80% 25.40% 1.30% 1.43% NA
Tropical Japonica  504 49.20% 40.70% 6.35% 3.77% NA
Japonica Intermediate  241 76.80% 20.70% 0.83% 1.66% NA
VI/Aromatic  96 33.30% 0.00% 16.67% 50.00% NA
Intermediate  90 31.10% 12.20% 15.56% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0111937827 T -> DEL N N silent_mutation Average:27.559; most accessible tissue: Zhenshan97 flower, score: 40.565 N N N N
vg0111937827 T -> C LOC_Os01g21360.1 upstream_gene_variant ; 342.0bp to feature; MODIFIER silent_mutation Average:27.559; most accessible tissue: Zhenshan97 flower, score: 40.565 N N N N
vg0111937827 T -> C LOC_Os01g21360-LOC_Os01g21380 intergenic_region ; MODIFIER silent_mutation Average:27.559; most accessible tissue: Zhenshan97 flower, score: 40.565 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0111937827 NA 9.00E-12 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0111937827 NA 2.89E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111937827 NA 1.04E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111937827 NA 4.14E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111937827 NA 1.04E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111937827 NA 2.89E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111937827 NA 6.10E-10 mr1162 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111937827 NA 8.81E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111937827 NA 7.23E-08 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111937827 NA 2.95E-06 mr1263 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111937827 NA 2.95E-06 mr1451 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111937827 NA 7.47E-06 mr1652 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111937827 NA 9.98E-06 mr1709 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111937827 NA 4.92E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111937827 NA 3.75E-15 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111937827 NA 1.89E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111937827 NA 4.93E-09 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111937827 NA 8.63E-11 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251