Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0111937827:

Variant ID: vg0111937827 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 11937827
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.12, A: 0.01, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

TGTCAATGTTTAGCAATCCTAGGGTGATATGATCTCAAGTATGTCTCTAGAAATGTAAATTGCACAAATGTAAATGCGACAATCAAATGAGACAAGAAGA[T/C]
AAGAGATTTTTCACCGAGGTTCGGAAACTCGCCGGTTTCCTACTCCCCGTTGAGGCGAGCCCAACTCCACCGCTCAACCACGAAGCCACCGCACGCCCCC

Reverse complement sequence

GGGGGCGTGCGGTGGCTTCGTGGTTGAGCGGTGGAGTTGGGCTCGCCTCAACGGGGAGTAGGAAACCGGCGAGTTTCCGAACCTCGGTGAAAAATCTCTT[A/G]
TCTTCTTGTCTCATTTGATTGTCGCATTTACATTTGTGCAATTTACATTTCTAGAGACATACTTGAGATCATATCACCCTAGGATTGCTAAACATTGACA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	24.80%	11.90%	23.47%	39.84%	NA
All Indica	2759	4.60%	3.40%	33.13%	58.86%	NA
All Japonica	1512	65.10%	29.80%	2.91%	2.25%	NA
Aus	269	1.10%	1.90%	44.98%	52.04%	NA
Indica I	595	1.70%	2.90%	31.60%	63.87%	NA
Indica II	465	3.90%	4.70%	26.02%	65.38%	NA
Indica III	913	6.20%	3.00%	35.05%	55.75%	NA
Indica Intermediate	786	5.20%	3.70%	36.26%	54.83%	NA
Temperate Japonica	767	71.80%	25.40%	1.30%	1.43%	NA
Tropical Japonica	504	49.20%	40.70%	6.35%	3.77%	NA
Japonica Intermediate	241	76.80%	20.70%	0.83%	1.66%	NA
VI/Aromatic	96	33.30%	0.00%	16.67%	50.00%	NA
Intermediate	90	31.10%	12.20%	15.56%	41.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0111937827	T -> DEL	N	N	silent_mutation	Average:27.559; most accessible tissue: Zhenshan97 flower, score: 40.565	N	N	N	N
vg0111937827	T -> C	LOC_Os01g21360.1	upstream_gene_variant ; 342.0bp to feature; MODIFIER	silent_mutation	Average:27.559; most accessible tissue: Zhenshan97 flower, score: 40.565	N	N	N	N
vg0111937827	T -> C	LOC_Os01g21360-LOC_Os01g21380	intergenic_region ; MODIFIER	silent_mutation	Average:27.559; most accessible tissue: Zhenshan97 flower, score: 40.565	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0111937827	NA	9.00E-12	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0111937827	NA	2.89E-07	mr1040	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111937827	NA	1.04E-06	mr1044	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111937827	NA	4.14E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111937827	NA	1.04E-15	mr1156	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111937827	NA	2.89E-06	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111937827	NA	6.10E-10	mr1162	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111937827	NA	8.81E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111937827	NA	7.23E-08	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111937827	NA	2.95E-06	mr1263	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111937827	NA	2.95E-06	mr1451	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111937827	NA	7.47E-06	mr1652	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111937827	NA	9.98E-06	mr1709	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111937827	NA	4.92E-06	mr1740	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111937827	NA	3.75E-15	mr1741	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111937827	NA	1.89E-07	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111937827	NA	4.93E-09	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111937827	NA	8.63E-11	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251