\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0111375416:

Variant ID: vg0111375416 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 11375416
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


ACCTGGGTTTCCAAACTCGAAACCAAACATTGTAGACCCATAATCCGATAGCTAAGTGTCACCCCTAAACCTGTCATTTAGTGTAGCTTAGGTTTACCCC[G/A]
GCTTAATGTTTAGCTAAAAATGATGGTACAATATAGGTCTAAATTGAATTTGTTGTAAATTACTTTCCACACCACTTGATAGTGCCAAAATAGCAGCTCC

Reverse complement sequence

GGAGCTGCTATTTTGGCACTATCAAGTGGTGTGGAAAGTAATTTACAACAAATTCAATTTAGACCTATATTGTACCATCATTTTTAGCTAAACATTAAGC[C/T]
GGGGTAAACCTAAGCTACACTAAATGACAGGTTTAGGGGTGACACTTAGCTATCGGATTATGGGTCTACAATGTTTGGTTTCGAGTTTGGAAACCCAGGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.70% 27.50% 0.08% 0.68% NA
All Indica  2759 89.50% 10.20% 0.11% 0.18% NA
All Japonica  1512 36.50% 63.50% 0.00% 0.00% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 77.50% 22.20% 0.34% 0.00% NA
Indica II  465 84.70% 14.60% 0.00% 0.65% NA
Indica III  913 98.80% 0.90% 0.11% 0.22% NA
Indica Intermediate  786 90.60% 9.40% 0.00% 0.00% NA
Temperate Japonica  767 60.20% 39.80% 0.00% 0.00% NA
Tropical Japonica  504 7.10% 92.90% 0.00% 0.00% NA
Japonica Intermediate  241 22.40% 77.60% 0.00% 0.00% NA
VI/Aromatic  96 44.80% 29.20% 0.00% 26.04% NA
Intermediate  90 62.20% 35.60% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0111375416 G -> A LOC_Os01g20030.1 upstream_gene_variant ; 3572.0bp to feature; MODIFIER silent_mutation Average:47.342; most accessible tissue: Minghui63 root, score: 57.225 N N N N
vg0111375416 G -> A LOC_Os01g20020.1 downstream_gene_variant ; 980.0bp to feature; MODIFIER silent_mutation Average:47.342; most accessible tissue: Minghui63 root, score: 57.225 N N N N
vg0111375416 G -> A LOC_Os01g20020-LOC_Os01g20030 intergenic_region ; MODIFIER silent_mutation Average:47.342; most accessible tissue: Minghui63 root, score: 57.225 N N N N
vg0111375416 G -> DEL N N silent_mutation Average:47.342; most accessible tissue: Minghui63 root, score: 57.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0111375416 NA 5.25E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0111375416 NA 8.99E-14 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0111375416 NA 5.61E-08 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416 NA 2.51E-09 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416 NA 5.85E-08 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416 NA 1.10E-07 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416 NA 1.41E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416 NA 5.46E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416 NA 3.97E-06 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416 NA 1.86E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416 NA 2.96E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416 NA 3.31E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416 NA 2.99E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416 NA 4.27E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416 NA 1.89E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416 NA 1.79E-06 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416 NA 6.09E-07 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416 NA 3.27E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416 NA 1.56E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416 NA 3.86E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416 NA 1.73E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416 NA 1.62E-11 mr1668_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416 NA 3.91E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251