Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0111375416:

Variant ID: vg0111375416 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 11375416
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

ACCTGGGTTTCCAAACTCGAAACCAAACATTGTAGACCCATAATCCGATAGCTAAGTGTCACCCCTAAACCTGTCATTTAGTGTAGCTTAGGTTTACCCC[G/A]
GCTTAATGTTTAGCTAAAAATGATGGTACAATATAGGTCTAAATTGAATTTGTTGTAAATTACTTTCCACACCACTTGATAGTGCCAAAATAGCAGCTCC

Reverse complement sequence

GGAGCTGCTATTTTGGCACTATCAAGTGGTGTGGAAAGTAATTTACAACAAATTCAATTTAGACCTATATTGTACCATCATTTTTAGCTAAACATTAAGC[C/T]
GGGGTAAACCTAAGCTACACTAAATGACAGGTTTAGGGGTGACACTTAGCTATCGGATTATGGGTCTACAATGTTTGGTTTCGAGTTTGGAAACCCAGGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.70%	27.50%	0.08%	0.68%	NA
All Indica	2759	89.50%	10.20%	0.11%	0.18%	NA
All Japonica	1512	36.50%	63.50%	0.00%	0.00%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	77.50%	22.20%	0.34%	0.00%	NA
Indica II	465	84.70%	14.60%	0.00%	0.65%	NA
Indica III	913	98.80%	0.90%	0.11%	0.22%	NA
Indica Intermediate	786	90.60%	9.40%	0.00%	0.00%	NA
Temperate Japonica	767	60.20%	39.80%	0.00%	0.00%	NA
Tropical Japonica	504	7.10%	92.90%	0.00%	0.00%	NA
Japonica Intermediate	241	22.40%	77.60%	0.00%	0.00%	NA
VI/Aromatic	96	44.80%	29.20%	0.00%	26.04%	NA
Intermediate	90	62.20%	35.60%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0111375416	G -> A	LOC_Os01g20030.1	upstream_gene_variant ; 3572.0bp to feature; MODIFIER	silent_mutation	Average:47.342; most accessible tissue: Minghui63 root, score: 57.225	N	N	N	N
vg0111375416	G -> A	LOC_Os01g20020.1	downstream_gene_variant ; 980.0bp to feature; MODIFIER	silent_mutation	Average:47.342; most accessible tissue: Minghui63 root, score: 57.225	N	N	N	N
vg0111375416	G -> A	LOC_Os01g20020-LOC_Os01g20030	intergenic_region ; MODIFIER	silent_mutation	Average:47.342; most accessible tissue: Minghui63 root, score: 57.225	N	N	N	N
vg0111375416	G -> DEL	N	N	silent_mutation	Average:47.342; most accessible tissue: Minghui63 root, score: 57.225	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0111375416	NA	5.25E-10	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0111375416	NA	8.99E-14	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0111375416	NA	5.61E-08	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416	NA	2.51E-09	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416	NA	5.85E-08	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416	NA	1.10E-07	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416	NA	1.41E-07	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416	NA	5.46E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416	NA	3.97E-06	mr1149_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416	NA	1.86E-07	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416	NA	2.96E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416	NA	3.31E-06	mr1206_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416	NA	2.99E-06	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416	NA	4.27E-07	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416	NA	1.89E-06	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416	NA	1.79E-06	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416	NA	6.09E-07	mr1441_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416	NA	3.27E-07	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416	NA	1.56E-06	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416	NA	3.86E-06	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416	NA	1.73E-10	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416	NA	1.62E-11	mr1668_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111375416	NA	3.91E-07	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251