Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0110800593:

Variant ID: vg0110800593 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 10800593
Reference Allele: G	Alternative Allele: A,GTA
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

TGTTATGTACTGCTCTCTCTCGCCCGTGTTACGCGGAATCATAATACTCCCTCCGTTTCAAAATGTTTGACGCCGTTGACTTTTTAGCACATGTTTGACC[G/A,GTA]
TTCGTCTTATTCAAAAAATTTAAGTAATTATTAATTCTTTTTCTATCATTTGATTCATTGTTAAATATATTTTGATGTAGGCATATAATTTTACATATTT

Reverse complement sequence

AAATATGTAAAATTATATGCCTACATCAAAATATATTTAACAATGAATCAAATGATAGAAAAAGAATTAATAATTACTTAAATTTTTTGAATAAGACGAA[C/T,TAC]
GGTCAAACATGTGCTAAAAAGTCAACGGCGTCAAACATTTTGAAACGGAGGGAGTATTATGATTCCGCGTAACACGGGCGAGAGAGAGCAGTACATAACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.00%	14.90%	0.06%	0.00%	NA
All Indica	2759	79.80%	20.20%	0.07%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	48.30%	51.30%	0.37%	0.00%	NA
Indica I	595	71.30%	28.70%	0.00%	0.00%	NA
Indica II	465	97.20%	2.80%	0.00%	0.00%	NA
Indica III	913	81.30%	18.60%	0.11%	0.00%	NA
Indica Intermediate	786	74.20%	25.70%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0110800593	G -> A	LOC_Os01g19110.1	downstream_gene_variant ; 1588.0bp to feature; MODIFIER	silent_mutation	Average:47.037; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg0110800593	G -> A	LOC_Os01g19120.1	downstream_gene_variant ; 1558.0bp to feature; MODIFIER	silent_mutation	Average:47.037; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg0110800593	G -> A	LOC_Os01g19130.1	downstream_gene_variant ; 4903.0bp to feature; MODIFIER	silent_mutation	Average:47.037; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg0110800593	G -> A	LOC_Os01g19110-LOC_Os01g19120	intergenic_region ; MODIFIER	silent_mutation	Average:47.037; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg0110800593	G -> GTA	LOC_Os01g19110.1	downstream_gene_variant ; 1589.0bp to feature; MODIFIER	N	Average:47.037; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg0110800593	G -> GTA	LOC_Os01g19120.1	downstream_gene_variant ; 1557.0bp to feature; MODIFIER	N	Average:47.037; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg0110800593	G -> GTA	LOC_Os01g19130.1	downstream_gene_variant ; 4902.0bp to feature; MODIFIER	N	Average:47.037; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg0110800593	G -> GTA	LOC_Os01g19110-LOC_Os01g19120	intergenic_region ; MODIFIER	N	Average:47.037; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0110800593	NA	1.98E-08	mr1280	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110800593	2.21E-06	3.87E-07	mr1280	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110800593	7.02E-07	4.53E-07	mr1788	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110800593	1.59E-07	3.88E-07	mr1788	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110800593	NA	5.09E-06	mr1887	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251