\
| Variant ID: vg0110162754 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 10162754 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 268. )
TGCTTACAAGAATTAATGTGCATTTTTTTGAAAGAATTATTTTCTTTGAGATCTTGATGTTTCTTGTCCAGGCATTCCCATGAGTTGCAAATCCAAGGAA[G/A]
TTGATAACAGCCATCTATACTAATATAAAAAGGAGGAGTTCACCCCTTCAATCCTACAGGTGAAATCATTCTATTTCATCTCATCCGTCCATCCGCCATC
GATGGCGGATGGACGGATGAGATGAAATAGAATGATTTCACCTGTAGGATTGAAGGGGTGAACTCCTCCTTTTTATATTAGTATAGATGGCTGTTATCAA[C/T]
TTCCTTGGATTTGCAACTCATGGGAATGCCTGGACAAGAAACATCAAGATCTCAAAGAAAATAATTCTTTCAAAAAAATGCACATTAATTCTTGTAAGCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.30% | 4.20% | 2.43% | 0.00% | NA |
| All Indica | 2759 | 89.60% | 6.50% | 3.84% | 0.00% | NA |
| All Japonica | 1512 | 98.50% | 1.30% | 0.20% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 84.00% | 5.90% | 10.08% | 0.00% | NA |
| Indica II | 465 | 96.30% | 2.60% | 1.08% | 0.00% | NA |
| Indica III | 913 | 92.90% | 6.70% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 86.10% | 9.20% | 4.71% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.00% | 3.60% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 1.10% | 5.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0110162754 | G -> A | LOC_Os01g18150.1 | upstream_gene_variant ; 1648.0bp to feature; MODIFIER | silent_mutation | Average:48.341; most accessible tissue: Callus, score: 75.784 | N | N | N | N |
| vg0110162754 | G -> A | LOC_Os01g18160.1 | upstream_gene_variant ; 3507.0bp to feature; MODIFIER | silent_mutation | Average:48.341; most accessible tissue: Callus, score: 75.784 | N | N | N | N |
| vg0110162754 | G -> A | LOC_Os01g18130.1 | downstream_gene_variant ; 4072.0bp to feature; MODIFIER | silent_mutation | Average:48.341; most accessible tissue: Callus, score: 75.784 | N | N | N | N |
| vg0110162754 | G -> A | LOC_Os01g18140.1 | downstream_gene_variant ; 2076.0bp to feature; MODIFIER | silent_mutation | Average:48.341; most accessible tissue: Callus, score: 75.784 | N | N | N | N |
| vg0110162754 | G -> A | LOC_Os01g18140-LOC_Os01g18150 | intergenic_region ; MODIFIER | silent_mutation | Average:48.341; most accessible tissue: Callus, score: 75.784 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0110162754 | NA | 4.01E-07 | mr1013 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110162754 | NA | 1.64E-06 | mr1031 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110162754 | NA | 5.10E-06 | mr1056 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110162754 | NA | 3.22E-06 | mr1125 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110162754 | 2.48E-06 | NA | mr1478 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110162754 | NA | 2.96E-06 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |