\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0110162754:

Variant ID: vg0110162754 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 10162754
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


TGCTTACAAGAATTAATGTGCATTTTTTTGAAAGAATTATTTTCTTTGAGATCTTGATGTTTCTTGTCCAGGCATTCCCATGAGTTGCAAATCCAAGGAA[G/A]
TTGATAACAGCCATCTATACTAATATAAAAAGGAGGAGTTCACCCCTTCAATCCTACAGGTGAAATCATTCTATTTCATCTCATCCGTCCATCCGCCATC

Reverse complement sequence

GATGGCGGATGGACGGATGAGATGAAATAGAATGATTTCACCTGTAGGATTGAAGGGGTGAACTCCTCCTTTTTATATTAGTATAGATGGCTGTTATCAA[C/T]
TTCCTTGGATTTGCAACTCATGGGAATGCCTGGACAAGAAACATCAAGATCTCAAAGAAAATAATTCTTTCAAAAAAATGCACATTAATTCTTGTAAGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.30% 4.20% 2.43% 0.00% NA
All Indica  2759 89.60% 6.50% 3.84% 0.00% NA
All Japonica  1512 98.50% 1.30% 0.20% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 84.00% 5.90% 10.08% 0.00% NA
Indica II  465 96.30% 2.60% 1.08% 0.00% NA
Indica III  913 92.90% 6.70% 0.44% 0.00% NA
Indica Intermediate  786 86.10% 9.20% 4.71% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 96.00% 3.60% 0.40% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 1.10% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0110162754 G -> A LOC_Os01g18150.1 upstream_gene_variant ; 1648.0bp to feature; MODIFIER silent_mutation Average:48.341; most accessible tissue: Callus, score: 75.784 N N N N
vg0110162754 G -> A LOC_Os01g18160.1 upstream_gene_variant ; 3507.0bp to feature; MODIFIER silent_mutation Average:48.341; most accessible tissue: Callus, score: 75.784 N N N N
vg0110162754 G -> A LOC_Os01g18130.1 downstream_gene_variant ; 4072.0bp to feature; MODIFIER silent_mutation Average:48.341; most accessible tissue: Callus, score: 75.784 N N N N
vg0110162754 G -> A LOC_Os01g18140.1 downstream_gene_variant ; 2076.0bp to feature; MODIFIER silent_mutation Average:48.341; most accessible tissue: Callus, score: 75.784 N N N N
vg0110162754 G -> A LOC_Os01g18140-LOC_Os01g18150 intergenic_region ; MODIFIER silent_mutation Average:48.341; most accessible tissue: Callus, score: 75.784 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0110162754 NA 4.01E-07 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110162754 NA 1.64E-06 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110162754 NA 5.10E-06 mr1056 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110162754 NA 3.22E-06 mr1125 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110162754 2.48E-06 NA mr1478 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110162754 NA 2.96E-06 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251