| Variant ID: vg0110154128 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 10154128 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAAAAGCCTCTTCGAGACAGTGCAAATAAAAAGCCTCTTCGAGGAGACCAGTGGTGACAAAATGATTTTTTTAGAAAAGGGTGTTTTTTATCCGGCATGT[G/A]
AAATTTGCTCTTATAGAGATTTGAACTCAGGACTTTGGAGTACTACTCAAGTCACTGCAACCACTGTACTACATGATAATTATGTGTTTTTTATTTCGTA
TACGAAATAAAAAACACATAATTATCATGTAGTACAGTGGTTGCAGTGACTTGAGTAGTACTCCAAAGTCCTGAGTTCAAATCTCTATAAGAGCAAATTT[C/T]
ACATGCCGGATAAAAAACACCCTTTTCTAAAAAAATCATTTTGTCACCACTGGTCTCCTCGAAGAGGCTTTTTATTTGCACTGTCTCGAAGAGGCTTTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.30% | 3.60% | 1.80% | 1.31% | NA |
| All Indica | 2759 | 89.40% | 5.60% | 2.72% | 2.25% | NA |
| All Japonica | 1512 | 98.60% | 1.00% | 0.40% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.20% | 5.20% | 5.55% | 0.00% | NA |
| Indica II | 465 | 95.90% | 2.20% | 1.08% | 0.86% | NA |
| Indica III | 913 | 88.20% | 6.50% | 0.55% | 4.82% | NA |
| Indica Intermediate | 786 | 87.20% | 7.00% | 4.07% | 1.78% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.20% | 2.80% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 1.10% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0110154128 | G -> A | LOC_Os01g18130.1 | upstream_gene_variant ; 2290.0bp to feature; MODIFIER | silent_mutation | Average:40.364; most accessible tissue: Zhenshan97 flower, score: 62.374 | N | N | N | N |
| vg0110154128 | G -> A | LOC_Os01g18120.1 | downstream_gene_variant ; 1608.0bp to feature; MODIFIER | silent_mutation | Average:40.364; most accessible tissue: Zhenshan97 flower, score: 62.374 | N | N | N | N |
| vg0110154128 | G -> A | LOC_Os01g18120-LOC_Os01g18130 | intergenic_region ; MODIFIER | silent_mutation | Average:40.364; most accessible tissue: Zhenshan97 flower, score: 62.374 | N | N | N | N |
| vg0110154128 | G -> DEL | N | N | silent_mutation | Average:40.364; most accessible tissue: Zhenshan97 flower, score: 62.374 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0110154128 | 9.35E-06 | 6.01E-09 | mr1013 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110154128 | NA | 3.99E-06 | mr1015 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110154128 | NA | 5.78E-08 | mr1031 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110154128 | NA | 8.53E-08 | mr1034 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110154128 | NA | 1.06E-07 | mr1056 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110154128 | NA | 4.33E-06 | mr1477 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110154128 | 5.45E-06 | NA | mr1478 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110154128 | NA | 2.39E-06 | mr1608 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |