\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0109907541:

Variant ID: vg0109907541 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 9907541
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGGTTGGATAGAAATGTCCCCGGCCCCGCTCCCCACATTCTCCCCCCGGCCTCTCCCTCGGCCCCACAGACACAACCAGGTGAAAAATGTCACCCGCCCA[A/G]
CCCCCGTAGGGGACCTGGCGGGCCCCACTCACCCGGATGCGTGAACAGTGAGTGGCGGTGGCGGGGATTCGTAAAAATGTCATTTCAAAAAATATGTTTA

Reverse complement sequence

TAAACATATTTTTTGAAATGACATTTTTACGAATCCCCGCCACCGCCACTCACTGTTCACGCATCCGGGTGAGTGGGGCCCGCCAGGTCCCCTACGGGGG[T/C]
TGGGCGGGTGACATTTTTCACCTGGTTGTGTCTGTGGGGCCGAGGGAGAGGCCGGGGGGAGAATGTGGGGAGCGGGGCCGGGGACATTTCTATCCAACCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.70% 31.30% 0.04% 0.00% NA
All Indica  2759 98.80% 1.20% 0.00% 0.00% NA
All Japonica  1512 7.30% 92.50% 0.13% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 99.00% 1.00% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 1.70% 0.00% 0.00% NA
Temperate Japonica  767 4.00% 95.80% 0.13% 0.00% NA
Tropical Japonica  504 7.30% 92.70% 0.00% 0.00% NA
Japonica Intermediate  241 17.80% 81.70% 0.41% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 62.20% 37.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0109907541 A -> G LOC_Os01g17214.1 upstream_gene_variant ; 4803.0bp to feature; MODIFIER silent_mutation Average:70.328; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0109907541 A -> G LOC_Os01g17214-LOC_Os01g17240 intergenic_region ; MODIFIER silent_mutation Average:70.328; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0109907541 1.24E-06 NA mr1049 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109907541 NA 9.01E-44 mr1141 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109907541 NA 3.34E-09 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109907541 NA 4.26E-39 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109907541 NA 7.75E-36 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109907541 NA 3.66E-50 mr1519 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109907541 NA 4.78E-21 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109907541 NA 1.82E-23 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109907541 NA 3.56E-21 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109907541 NA 8.18E-43 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109907541 NA 4.90E-57 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109907541 NA 5.30E-27 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109907541 NA 1.80E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109907541 NA 5.45E-30 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109907541 NA 3.67E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109907541 NA 9.69E-24 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109907541 NA 4.37E-40 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109907541 NA 1.48E-13 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109907541 NA 6.94E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109907541 NA 2.00E-44 mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109907541 NA 3.24E-27 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109907541 NA 6.58E-21 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251