| Variant ID: vg0109677594 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 9677594 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GCATATATTAATTATTCATAACTTTTATGGTCATTTTCATGCTAAATGGAAAAAAAACCACCTAATAAGAGATAACTTTTAATCCTACCGATATACTATT[C/T]
CTATCTTATTTTATCCTAACTTTTTTCACTCAGTTTTGTTCATATTTTTTTATATTGCAAATGGCAAGAAGAGTAAAACGTTAACCAATGTTTACCGCAT
ATGCGGTAAACATTGGTTAACGTTTTACTCTTCTTGCCATTTGCAATATAAAAAAATATGAACAAAACTGAGTGAAAAAAGTTAGGATAAAATAAGATAG[G/A]
AATAGTATATCGGTAGGATTAAAAGTTATCTCTTATTAGGTGGTTTTTTTTCCATTTAGCATGAAAATGACCATAAAAGTTATGAATAATTAATATATGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.70% | 7.70% | 2.58% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 68.50% | 23.90% | 7.67% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.10% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 43.30% | 43.70% | 13.04% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 1.00% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 86.70% | 8.70% | 4.56% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 1.10% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0109677594 | C -> T | LOC_Os01g16910.1 | upstream_gene_variant ; 1847.0bp to feature; MODIFIER | silent_mutation | Average:32.91; most accessible tissue: Zhenshan97 root, score: 43.05 | N | N | N | N |
| vg0109677594 | C -> T | LOC_Os01g16920.1 | upstream_gene_variant ; 2234.0bp to feature; MODIFIER | silent_mutation | Average:32.91; most accessible tissue: Zhenshan97 root, score: 43.05 | N | N | N | N |
| vg0109677594 | C -> T | LOC_Os01g16930.1 | downstream_gene_variant ; 4972.0bp to feature; MODIFIER | silent_mutation | Average:32.91; most accessible tissue: Zhenshan97 root, score: 43.05 | N | N | N | N |
| vg0109677594 | C -> T | LOC_Os01g16910-LOC_Os01g16920 | intergenic_region ; MODIFIER | silent_mutation | Average:32.91; most accessible tissue: Zhenshan97 root, score: 43.05 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0109677594 | 3.13E-07 | NA | mr1300 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109677594 | NA | 4.50E-07 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109677594 | 4.09E-06 | NA | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109677594 | NA | 5.36E-07 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109677594 | 3.55E-07 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109677594 | NA | 1.57E-07 | mr1926 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109677594 | NA | 6.16E-10 | mr1959 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109677594 | NA | 8.14E-06 | mr1959 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |