\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0109677594:

Variant ID: vg0109677594 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 9677594
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCATATATTAATTATTCATAACTTTTATGGTCATTTTCATGCTAAATGGAAAAAAAACCACCTAATAAGAGATAACTTTTAATCCTACCGATATACTATT[C/T]
CTATCTTATTTTATCCTAACTTTTTTCACTCAGTTTTGTTCATATTTTTTTATATTGCAAATGGCAAGAAGAGTAAAACGTTAACCAATGTTTACCGCAT

Reverse complement sequence

ATGCGGTAAACATTGGTTAACGTTTTACTCTTCTTGCCATTTGCAATATAAAAAAATATGAACAAAACTGAGTGAAAAAAGTTAGGATAAAATAAGATAG[G/A]
AATAGTATATCGGTAGGATTAAAAGTTATCTCTTATTAGGTGGTTTTTTTTCCATTTAGCATGAAAATGACCATAAAAGTTATGAATAATTAATATATGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.70% 7.70% 2.58% 0.00% NA
All Indica  2759 99.90% 0.00% 0.11% 0.00% NA
All Japonica  1512 68.50% 23.90% 7.67% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.10% 0.25% 0.00% NA
Temperate Japonica  767 43.30% 43.70% 13.04% 0.00% NA
Tropical Japonica  504 98.00% 1.00% 0.99% 0.00% NA
Japonica Intermediate  241 86.70% 8.70% 4.56% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 1.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0109677594 C -> T LOC_Os01g16910.1 upstream_gene_variant ; 1847.0bp to feature; MODIFIER silent_mutation Average:32.91; most accessible tissue: Zhenshan97 root, score: 43.05 N N N N
vg0109677594 C -> T LOC_Os01g16920.1 upstream_gene_variant ; 2234.0bp to feature; MODIFIER silent_mutation Average:32.91; most accessible tissue: Zhenshan97 root, score: 43.05 N N N N
vg0109677594 C -> T LOC_Os01g16930.1 downstream_gene_variant ; 4972.0bp to feature; MODIFIER silent_mutation Average:32.91; most accessible tissue: Zhenshan97 root, score: 43.05 N N N N
vg0109677594 C -> T LOC_Os01g16910-LOC_Os01g16920 intergenic_region ; MODIFIER silent_mutation Average:32.91; most accessible tissue: Zhenshan97 root, score: 43.05 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0109677594 3.13E-07 NA mr1300 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109677594 NA 4.50E-07 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109677594 4.09E-06 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109677594 NA 5.36E-07 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109677594 3.55E-07 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109677594 NA 1.57E-07 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109677594 NA 6.16E-10 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109677594 NA 8.14E-06 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251