Variant ID: vg0109580082 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 9580082 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GTTTGCCTCCTACTCTGTACTGCGCCGTCGCTCGTAGACTACTCCATCCCGCTCGCCGGCGTGCACCAGCGATCGGGAGAGCAGGTCTCCAGAACCTCTG[T/C]
CTTTGACGTCCTGCACCGGGAGAAGGCGGCAATAAGGTTTTTGGGAAGCGCTTCGCGCGACTGCTCCCTGTTCGTTCGCGACGGCTCGCCTTCCTCTTCG
CGAAGAGGAAGGCGAGCCGTCGCGAACGAACAGGGAGCAGTCGCGCGAAGCGCTTCCCAAAAACCTTATTGCCGCCTTCTCCCGGTGCAGGACGTCAAAG[A/G]
CAGAGGTTCTGGAGACCTGCTCTCCCGATCGCTGGTGCACGCCGGCGAGCGGGATGGAGTAGTCTACGAGCGACGGCGCAGTACAGAGTAGGAGGCAAAC
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 34.70% | 0.10% | 0.15% | 65.00% | NA |
All Indica | 2759 | 4.60% | 0.20% | 0.07% | 95.18% | NA |
All Japonica | 1512 | 96.90% | 0.00% | 0.00% | 3.11% | NA |
Aus | 269 | 1.10% | 0.40% | 0.74% | 97.77% | NA |
Indica I | 595 | 7.10% | 0.20% | 0.00% | 92.77% | NA |
Indica II | 465 | 1.70% | 0.40% | 0.00% | 97.85% | NA |
Indica III | 913 | 3.80% | 0.20% | 0.11% | 95.84% | NA |
Indica Intermediate | 786 | 5.20% | 0.00% | 0.13% | 94.66% | NA |
Temperate Japonica | 767 | 98.70% | 0.00% | 0.00% | 1.30% | NA |
Tropical Japonica | 504 | 94.60% | 0.00% | 0.00% | 5.36% | NA |
Japonica Intermediate | 241 | 95.90% | 0.00% | 0.00% | 4.15% | NA |
VI/Aromatic | 96 | 10.40% | 0.00% | 0.00% | 89.58% | NA |
Intermediate | 90 | 41.10% | 0.00% | 3.33% | 55.56% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0109580082 | T -> DEL | N | N | silent_mutation | Average:10.033; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
vg0109580082 | T -> C | LOC_Os01g16820.1 | downstream_gene_variant ; 1168.0bp to feature; MODIFIER | silent_mutation | Average:10.033; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
vg0109580082 | T -> C | LOC_Os01g16820-LOC_Os01g16840 | intergenic_region ; MODIFIER | silent_mutation | Average:10.033; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0109580082 | NA | 1.63E-06 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0109580082 | NA | 2.97E-06 | mr1289_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0109580082 | NA | 8.82E-06 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0109580082 | NA | 3.74E-07 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0109580082 | NA | 2.61E-09 | mr1506_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0109580082 | NA | 3.80E-07 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0109580082 | NA | 3.21E-12 | mr1636_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0109580082 | NA | 2.99E-19 | mr1682_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0109580082 | NA | 1.02E-09 | mr1683_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0109580082 | NA | 3.70E-07 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0109580082 | NA | 3.18E-14 | mr1838_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |