\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0109413217:

Variant ID: vg0109413217 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 9413217
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGGATGATGACAAGAATCATCTCAACTTCAAATGGCCATAATTTACGAACTAACGATTTCCCAAACCAAGAAGATTTTGTTTGCACTGATTGTGCAACA[G/A]
CGAAATTAATCGTTAGACCCTCTAATCTAAAGGTGAACGCAGAATCACCAGTATTCTTGCAACGAATACAGGGAAACATATGTGGACCAATTAATCCCAT

Reverse complement sequence

ATGGGATTAATTGGTCCACATATGTTTCCCTGTATTCGTTGCAAGAATACTGGTGATTCTGCGTTCACCTTTAGATTAGAGGGTCTAACGATTAATTTCG[C/T]
TGTTGCACAATCAGTGCAAACAAAATCTTCTTGGTTTGGGAAATCGTTAGTTCGTAAATTATGGCCATTTGAAGTTGAGATGATTCTTGTCATCATCCCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.20% 37.60% 0.23% 0.00% NA
All Indica  2759 96.70% 3.20% 0.18% 0.00% NA
All Japonica  1512 3.10% 96.60% 0.26% 0.00% NA
Aus  269 38.70% 61.30% 0.00% 0.00% NA
Indica I  595 95.80% 3.90% 0.34% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 99.00% 0.90% 0.11% 0.00% NA
Indica Intermediate  786 93.50% 6.20% 0.25% 0.00% NA
Temperate Japonica  767 1.80% 98.00% 0.13% 0.00% NA
Tropical Japonica  504 5.20% 94.60% 0.20% 0.00% NA
Japonica Intermediate  241 2.90% 96.30% 0.83% 0.00% NA
VI/Aromatic  96 72.90% 27.10% 0.00% 0.00% NA
Intermediate  90 56.70% 41.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0109413217 G -> A LOC_Os01g16580.1 upstream_gene_variant ; 178.0bp to feature; MODIFIER silent_mutation Average:19.668; most accessible tissue: Callus, score: 31.15 N N N N
vg0109413217 G -> A LOC_Os01g16570.1 downstream_gene_variant ; 864.0bp to feature; MODIFIER silent_mutation Average:19.668; most accessible tissue: Callus, score: 31.15 N N N N
vg0109413217 G -> A LOC_Os01g16570-LOC_Os01g16580 intergenic_region ; MODIFIER silent_mutation Average:19.668; most accessible tissue: Callus, score: 31.15 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0109413217 6.25E-06 NA mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109413217 5.85E-06 NA mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109413217 NA 4.40E-39 mr1139 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109413217 3.67E-06 NA mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109413217 5.01E-06 NA mr1233 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109413217 NA 1.15E-25 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109413217 NA 1.07E-17 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109413217 NA 5.47E-18 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109413217 NA 4.01E-31 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109413217 NA 2.01E-14 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109413217 NA 8.63E-26 mr1264 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109413217 5.52E-06 NA mr1264 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109413217 NA 1.14E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109413217 NA 1.44E-36 mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109413217 NA 2.79E-40 mr1437 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109413217 4.73E-06 NA mr1437 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109413217 NA 2.35E-09 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109413217 NA 3.07E-31 mr1878 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251