Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0108674689:

Variant ID: vg0108674689 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 8674689
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATCCCGGCGAAGGAGAAAACCAAGGAAAGAGAAGGGGCAATCTGGGCATTTAGAAAAATATCTCACCTCTTTTGATCCGAAAATAATAAAATAATACGA[C/T]
AAGTGTCCTATAGCTAATTACACAATTTTTGTAGTGTCCGTTAGCCGTATCACGTTTTCGCGGTGTCTTCCAGCTAATTACACGTTTTTTGCGTGTCCTG

Reverse complement sequence

CAGGACACGCAAAAAACGTGTAATTAGCTGGAAGACACCGCGAAAACGTGATACGGCTAACGGACACTACAAAAATTGTGTAATTAGCTATAGGACACTT[G/A]
TCGTATTATTTTATTATTTTCGGATCAAAAGAGGTGAGATATTTTTCTAAATGCCCAGATTGCCCCTTCTCTTTCCTTGGTTTTCTCCTTCGCCGGGATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.50% 0.60% 7.02% 36.90% NA
All Indica  2759 39.80% 1.00% 8.59% 50.56% NA
All Japonica  1512 84.00% 0.00% 4.63% 11.38% NA
Aus  269 39.40% 0.00% 5.20% 55.39% NA
Indica I  595 39.50% 0.00% 9.58% 50.92% NA
Indica II  465 29.90% 3.40% 9.25% 57.42% NA
Indica III  913 45.20% 0.90% 6.35% 47.54% NA
Indica Intermediate  786 39.70% 0.50% 10.05% 49.75% NA
Temperate Japonica  767 77.70% 0.00% 6.52% 15.78% NA
Tropical Japonica  504 90.50% 0.00% 2.38% 7.14% NA
Japonica Intermediate  241 90.50% 0.00% 3.32% 6.22% NA
VI/Aromatic  96 91.70% 1.00% 2.08% 5.21% NA
Intermediate  90 64.40% 0.00% 10.00% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0108674689 C -> T LOC_Os01g15460-LOC_Os01g15470 intergenic_region ; MODIFIER silent_mutation Average:81.056; most accessible tissue: Zhenshan97 root, score: 92.426 N N N N
vg0108674689 C -> DEL N N silent_mutation Average:81.056; most accessible tissue: Zhenshan97 root, score: 92.426 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0108674689 NA 9.02E-08 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108674689 NA 6.03E-07 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108674689 NA 8.95E-08 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108674689 NA 3.28E-06 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108674689 NA 2.95E-06 mr1145 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108674689 NA 1.63E-06 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108674689 NA 2.32E-10 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108674689 NA 1.05E-08 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108674689 NA 1.99E-09 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108674689 NA 5.10E-06 mr1436 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108674689 NA 3.42E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108674689 NA 2.15E-10 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108674689 NA 4.89E-07 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108674689 NA 8.39E-08 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108674689 NA 7.91E-11 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108674689 NA 1.84E-08 mr1227_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108674689 NA 1.28E-10 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108674689 3.35E-06 3.35E-06 mr1356_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108674689 NA 1.29E-06 mr1358_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108674689 NA 4.77E-09 mr1403_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108674689 NA 1.09E-14 mr1410_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108674689 NA 3.76E-07 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108674689 NA 3.20E-06 mr1500_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108674689 NA 5.82E-06 mr1554_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108674689 NA 7.24E-06 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108674689 NA 6.08E-09 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108674689 7.41E-07 3.68E-08 mr1622_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108674689 NA 7.27E-07 mr1649_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108674689 NA 7.35E-08 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108674689 NA 1.55E-06 mr1862_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108674689 NA 4.58E-08 mr1866_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108674689 NA 8.34E-07 mr1956_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108674689 NA 4.60E-10 mr1993_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251