\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0108113890:

Variant ID: vg0108113890 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 8113890
Reference Allele: GGGTAlternative Allele: GCACCCACAATAGTAAAGTAAGGT,AGGT,G,TGGT
Primary Allele: GGGTSecondary Allele: AGGT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATCTCAGAAATTAATGTTGTAGTAGGGTACCCATTCCATCCTTGCTACTACTAGTACATTTTATGTTGGAGATAGAGATGCTGAGATATATCGTCTAAG[GGGT/GCACCCACAATAGTAAAGTAAGGT,AGGT,G,TGGT]
GTTTGGAAACTAGGGACTAAAGTTTAATCCCTCTTACAAAAGTATAAGTCCCTAGGGGAGGGACTTATATTTTTGAGAGAGGGGCTAAAGTCTCGAAGTC

Reverse complement sequence

GACTTCGAGACTTTAGCCCCTCTCTCAAAAATATAAGTCCCTCCCCTAGGGACTTATACTTTTGTAAGAGGGATTAAACTTTAGTCCCTAGTTTCCAAAC[ACCC/ACCTTACTTTACTATTGTGGGTGC,ACCT,C,ACCA]
CTTAGACGATATATCTCAGCATCTCTATCTCCAACATAAAATGTACTAGTAGTAGCAAGGATGGAATGGGTACCCTACTACAACATTAATTTCTGAGATA

Allele Frequencies:

Populations Population SizeFrequency of GGGT(primary allele) Frequency of AGGT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.80% 5.60% 0.13% 0.00% G: 0.36%; TGGT: 0.13%; GCACCCACAATAGTAAAGTAAGGT: 0.02%
All Indica  2759 97.60% 1.40% 0.04% 0.00% G: 0.62%; TGGT: 0.22%; GCACCCACAATAGTAAAGTAAGGT: 0.04%
All Japonica  1512 99.30% 0.50% 0.20% 0.00% NA
Aus  269 20.10% 79.20% 0.74% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 96.50% 1.90% 0.11% 0.00% G: 1.42%; GCACCCACAATAGTAAAGTAAGGT: 0.11%
Indica Intermediate  786 95.80% 2.90% 0.00% 0.00% TGGT: 0.76%; G: 0.51%
Temperate Japonica  767 99.30% 0.40% 0.26% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0108113890 GGGT -> G LOC_Os01g14490.1 downstream_gene_variant ; 1664.0bp to feature; MODIFIER silent_mutation Average:80.731; most accessible tissue: Minghui63 root, score: 97.339 N N N N
vg0108113890 GGGT -> G LOC_Os01g14470-LOC_Os01g14490 intergenic_region ; MODIFIER silent_mutation Average:80.731; most accessible tissue: Minghui63 root, score: 97.339 N N N N
vg0108113890 GGGT -> GCACCCACAATAGTAAAGTAAGGT LOC_Os01g14490.1 downstream_gene_variant ; 1664.0bp to feature; MODIFIER silent_mutation Average:80.731; most accessible tissue: Minghui63 root, score: 97.339 N N N N
vg0108113890 GGGT -> GCACCCACAATAGTAAAGTAAGGT LOC_Os01g14470-LOC_Os01g14490 intergenic_region ; MODIFIER silent_mutation Average:80.731; most accessible tissue: Minghui63 root, score: 97.339 N N N N
vg0108113890 GGGT -> AGGT LOC_Os01g14490.1 downstream_gene_variant ; 1665.0bp to feature; MODIFIER silent_mutation Average:80.731; most accessible tissue: Minghui63 root, score: 97.339 N N N N
vg0108113890 GGGT -> AGGT LOC_Os01g14470-LOC_Os01g14490 intergenic_region ; MODIFIER silent_mutation Average:80.731; most accessible tissue: Minghui63 root, score: 97.339 N N N N
vg0108113890 GGGT -> TGGT LOC_Os01g14490.1 downstream_gene_variant ; 1665.0bp to feature; MODIFIER silent_mutation Average:80.731; most accessible tissue: Minghui63 root, score: 97.339 N N N N
vg0108113890 GGGT -> TGGT LOC_Os01g14470-LOC_Os01g14490 intergenic_region ; MODIFIER silent_mutation Average:80.731; most accessible tissue: Minghui63 root, score: 97.339 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0108113890 GGGT AGGT -0.01 -0.02 -0.01 -0.02 0.0 -0.01
vg0108113890 GGGT G -0.15 -0.28 -0.08 0.04 0.02 0.03
vg0108113890 GGGT GCACC* -0.46 -0.39 -0.28 -0.11 -0.23 -0.08
vg0108113890 GGGT TGGT -0.01 -0.03 -0.02 -0.03 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0108113890 NA 2.20E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 1.20E-23 mr1095 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 1.92E-30 mr1098 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 3.66E-28 mr1099 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 4.01E-28 mr1101 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 1.19E-16 mr1113 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 8.11E-19 mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 7.75E-19 mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 1.79E-16 mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 8.41E-22 mr1120 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 8.87E-25 mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 2.82E-06 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 2.04E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 6.76E-20 mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 1.07E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 5.73E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 2.90E-08 mr1348 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 1.51E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 9.20E-06 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 4.99E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 2.97E-06 mr1523 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 7.76E-47 mr1549 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 9.00E-10 2.67E-62 mr1550 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 4.14E-23 mr1589 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 6.78E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 4.92E-10 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 2.44E-10 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 2.14E-48 mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 4.13E-08 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 1.82E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 1.82E-24 mr1868 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 9.35E-17 mr1911 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 6.02E-07 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 5.93E-20 mr1936 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 7.54E-20 mr1961 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 9.18E-41 mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 1.60E-60 mr1550_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 1.37E-32 mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108113890 NA 3.25E-06 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251