Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0107950946:

Variant ID: vg0107950946 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7950946
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.03, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


GTTTGGTACAACTCTAACTCCTAAATTTAGCTTCAGGAGTTGAGTCTGGAGTAGAGTTGTGGAGCTGCCTAAAGCCCTAAACCTAGCTCCACAACTCTAG[T/C]
TCATTTTATGAGAGAGCTTCACCTAGCTCCGCTCCCAGTTTTGGTGGAGCTGAAACTATTTGGCTGAGCTGTAGCTCCAGGATGGGTGGAGCTGGAGCTA

Reverse complement sequence

TAGCTCCAGCTCCACCCATCCTGGAGCTACAGCTCAGCCAAATAGTTTCAGCTCCACCAAAACTGGGAGCGGAGCTAGGTGAAGCTCTCTCATAAAATGA[A/G]
CTAGAGTTGTGGAGCTAGGTTTAGGGCTTTAGGCAGCTCCACAACTCTACTCCAGACTCAACTCCTGAAGCTAAATTTAGGAGTTAGAGTTGTACCAAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.80% 27.10% 0.06% 0.00% NA
All Indica  2759 94.60% 5.40% 0.04% 0.00% NA
All Japonica  1512 44.20% 55.70% 0.13% 0.00% NA
Aus  269 0.70% 99.30% 0.00% 0.00% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 96.80% 3.20% 0.00% 0.00% NA
Indica III  913 91.90% 8.10% 0.00% 0.00% NA
Indica Intermediate  786 92.90% 7.00% 0.13% 0.00% NA
Temperate Japonica  767 5.60% 94.30% 0.13% 0.00% NA
Tropical Japonica  504 94.60% 5.20% 0.20% 0.00% NA
Japonica Intermediate  241 61.40% 38.60% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107950946 T -> C LOC_Os01g14180.1 upstream_gene_variant ; 3974.0bp to feature; MODIFIER silent_mutation Average:39.698; most accessible tissue: Zhenshan97 young leaf, score: 53.969 N N N N
vg0107950946 T -> C LOC_Os01g14200.1 upstream_gene_variant ; 2477.0bp to feature; MODIFIER silent_mutation Average:39.698; most accessible tissue: Zhenshan97 young leaf, score: 53.969 N N N N
vg0107950946 T -> C LOC_Os01g14190.1 downstream_gene_variant ; 1143.0bp to feature; MODIFIER silent_mutation Average:39.698; most accessible tissue: Zhenshan97 young leaf, score: 53.969 N N N N
vg0107950946 T -> C LOC_Os01g14190-LOC_Os01g14200 intergenic_region ; MODIFIER silent_mutation Average:39.698; most accessible tissue: Zhenshan97 young leaf, score: 53.969 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107950946 NA 2.92E-13 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 1.93E-13 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 1.19E-07 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 1.26E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 1.18E-18 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 2.75E-29 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 1.54E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 2.82E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 4.16E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 1.76E-10 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 4.00E-10 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 8.99E-21 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 1.94E-09 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 9.82E-11 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 4.32E-19 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 7.69E-11 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 2.91E-15 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 8.91E-08 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 5.11E-06 NA mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 1.81E-06 NA mr1693 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 6.76E-16 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 1.08E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 3.66E-13 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 2.94E-20 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 6.32E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 4.58E-07 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 4.33E-08 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 7.27E-08 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 4.85E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 2.44E-06 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 1.41E-06 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 7.75E-13 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 1.63E-09 mr1364_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 2.33E-24 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 7.72E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 5.08E-17 mr1539_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 2.31E-18 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 3.19E-11 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 1.08E-06 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 9.41E-17 mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 1.42E-14 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 1.95E-18 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 2.05E-16 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 6.46E-10 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107950946 NA 6.36E-11 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251