\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107834437:

Variant ID: vg0107834437 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7834437
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCATGGCAAAGCTTTTCGATAACCTCGCATTGGCAGTACCCGCTCCATGAACTTCACATCCTCATGCACTCTAGGCGTACACGGTTTCTAGCAGTGAGA[G/A]
GAGTTCTGGCGCACCCGGGAAGAAAAGACTCACACATGCATTAATTAATTTATAATTATGTTTAAATTCTCACATGGCAGTCCTACCGATGGCGACACCA

Reverse complement sequence

TGGTGTCGCCATCGGTAGGACTGCCATGTGAGAATTTAAACATAATTATAAATTAATTAATGCATGTGTGAGTCTTTTCTTCCCGGGTGCGCCAGAACTC[C/T]
TCTCACTGCTAGAAACCGTGTACGCCTAGAGTGCATGAGGATGTGAAGTTCATGGAGCGGGTACTGCCAATGCGAGGTTATCGAAAAGCTTTGCCATGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.40% 0.40% 3.03% 4.13% NA
All Indica  2759 93.70% 0.60% 2.97% 2.75% NA
All Japonica  1512 99.90% 0.00% 0.00% 0.13% NA
Aus  269 34.90% 1.10% 21.56% 42.38% NA
Indica I  595 95.60% 0.30% 2.18% 1.85% NA
Indica II  465 93.50% 0.90% 1.94% 3.66% NA
Indica III  913 94.20% 0.40% 2.85% 2.52% NA
Indica Intermediate  786 91.70% 0.80% 4.33% 3.18% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 99.80% 0.00% 0.00% 0.20% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 95.60% 0.00% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107834437 G -> A LOC_Os01g13970.1 upstream_gene_variant ; 2220.0bp to feature; MODIFIER silent_mutation Average:12.987; most accessible tissue: Zhenshan97 root, score: 23.888 N N N N
vg0107834437 G -> A LOC_Os01g13980.1 upstream_gene_variant ; 620.0bp to feature; MODIFIER silent_mutation Average:12.987; most accessible tissue: Zhenshan97 root, score: 23.888 N N N N
vg0107834437 G -> A LOC_Os01g13990.1 downstream_gene_variant ; 2861.0bp to feature; MODIFIER silent_mutation Average:12.987; most accessible tissue: Zhenshan97 root, score: 23.888 N N N N
vg0107834437 G -> A LOC_Os01g13980-LOC_Os01g13990 intergenic_region ; MODIFIER silent_mutation Average:12.987; most accessible tissue: Zhenshan97 root, score: 23.888 N N N N
vg0107834437 G -> DEL N N silent_mutation Average:12.987; most accessible tissue: Zhenshan97 root, score: 23.888 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107834437 NA 1.47E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834437 NA 1.27E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834437 6.77E-06 3.95E-15 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834437 NA 1.27E-12 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834437 NA 1.33E-08 mr1608 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834437 NA 1.14E-06 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834437 NA 3.08E-34 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834437 NA 1.23E-20 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834437 NA 1.30E-15 mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834437 NA 2.98E-07 mr1897 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834437 NA 7.35E-06 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834437 3.95E-06 4.82E-12 mr1927 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834437 NA 2.16E-06 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834437 NA 5.81E-06 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834437 NA 6.35E-14 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834437 NA 1.09E-11 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834437 NA 1.24E-08 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834437 NA 7.35E-13 mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834437 NA 3.51E-08 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834437 NA 3.61E-17 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834437 NA 9.31E-12 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834437 NA 1.39E-35 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834437 NA 3.66E-18 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834437 NA 7.31E-15 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834437 NA 2.55E-09 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834437 NA 1.71E-15 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834437 NA 1.49E-10 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834437 NA 8.28E-19 mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834437 NA 3.64E-11 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251