\
| Variant ID: vg0107540499 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 7540499 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CTTAAAAACATGCAATCTCAATTACTTTTAGCTCAAAATTATATCAAATTGTTTTAATTTTGTACGTATTATGTAACTTAATTTTCTACAGCAACGCGAC[C/G]
AGATGTTCATATAGTATCTTATAAAAGTATGAGCAGTACTAGAATACTAAAACTGGAGAATACCGAATGTACTTACTTATAAACTGTAGGGGAAATTAAA
TTTAATTTCCCCTACAGTTTATAAGTAAGTACATTCGGTATTCTCCAGTTTTAGTATTCTAGTACTGCTCATACTTTTATAAGATACTATATGAACATCT[G/C]
GTCGCGTTGCTGTAGAAAATTAAGTTACATAATACGTACAAAATTAAAACAATTTGATATAATTTTGAGCTAAAAGTAATTGAGATTGCATGTTTTTAAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.30% | 26.40% | 0.30% | 0.00% | NA |
| All Indica | 2759 | 99.40% | 0.40% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 23.90% | 75.50% | 0.53% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.20% | 0.50% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 4.00% | 95.70% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 57.90% | 40.90% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 16.20% | 83.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 24.00% | 75.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 25.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0107540499 | C -> G | LOC_Os01g13510.1 | upstream_gene_variant ; 3172.0bp to feature; MODIFIER | silent_mutation | Average:32.542; most accessible tissue: Callus, score: 50.644 | N | N | N | N |
| vg0107540499 | C -> G | LOC_Os01g13500-LOC_Os01g13510 | intergenic_region ; MODIFIER | silent_mutation | Average:32.542; most accessible tissue: Callus, score: 50.644 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0107540499 | NA | 2.83E-06 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107540499 | NA | 6.70E-07 | mr1403 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107540499 | NA | 2.18E-10 | mr1691 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107540499 | NA | 4.50E-11 | mr1693 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107540499 | NA | 7.30E-07 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107540499 | NA | 2.43E-13 | mr1741 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107540499 | NA | 9.20E-06 | mr1741 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107540499 | NA | 8.16E-18 | mr1156_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107540499 | NA | 6.86E-06 | mr1224_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107540499 | NA | 2.32E-06 | mr1246_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107540499 | NA | 4.12E-09 | mr1624_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107540499 | NA | 3.19E-24 | mr1679_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107540499 | NA | 3.06E-07 | mr1679_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107540499 | NA | 2.44E-07 | mr1691_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |