\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107533941:

Variant ID: vg0107533941 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7533941
Reference Allele: GAlternative Allele: A,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


AAATAAAAAATAATTGCACAGTTAGGGAGAAAATCACGAGACAAATTTTTTTGAGCATAATTAGTCTATGATTAGTCATAAGTGCTACAGTAACCTACAT[G/A,T]
TGTTAATGATGGATTAATTAGGCTCAACAGATTCGTCTCGCCGTTTCCAGACGAGTTATGAAATTAGTTTTTTCATTCGTATTCAAAAACCCCTTTCAAC

Reverse complement sequence

GTTGAAAGGGGTTTTTGAATACGAATGAAAAAACTAATTTCATAACTCGTCTGGAAACGGCGAGACGAATCTGTTGAGCCTAATTAATCCATCATTAACA[C/T,A]
ATGTAGGTTACTGTAGCACTTATGACTAATCATAGACTAATTATGCTCAAAAAAATTTGTCTCGTGATTTTCTCCCTAACTGTGCAATTATTTTTTATTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.10% 37.70% 0.19% 0.00% T: 0.02%
All Indica  2759 92.00% 7.90% 0.07% 0.00% NA
All Japonica  1512 22.30% 77.40% 0.33% 0.00% NA
Aus  269 0.00% 99.60% 0.00% 0.00% T: 0.37%
Indica I  595 98.00% 1.80% 0.17% 0.00% NA
Indica II  465 89.90% 10.10% 0.00% 0.00% NA
Indica III  913 90.10% 9.70% 0.11% 0.00% NA
Indica Intermediate  786 91.00% 9.00% 0.00% 0.00% NA
Temperate Japonica  767 4.30% 95.70% 0.00% 0.00% NA
Tropical Japonica  504 53.40% 45.80% 0.79% 0.00% NA
Japonica Intermediate  241 14.50% 85.10% 0.41% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 60.00% 37.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107533941 G -> T LOC_Os01g13500.1 downstream_gene_variant ; 3805.0bp to feature; MODIFIER silent_mutation Average:80.443; most accessible tissue: Callus, score: 97.084 N N N N
vg0107533941 G -> T LOC_Os01g13500-LOC_Os01g13510 intergenic_region ; MODIFIER silent_mutation Average:80.443; most accessible tissue: Callus, score: 97.084 N N N N
vg0107533941 G -> A LOC_Os01g13500.1 downstream_gene_variant ; 3805.0bp to feature; MODIFIER silent_mutation Average:80.443; most accessible tissue: Callus, score: 97.084 N N N N
vg0107533941 G -> A LOC_Os01g13500-LOC_Os01g13510 intergenic_region ; MODIFIER silent_mutation Average:80.443; most accessible tissue: Callus, score: 97.084 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0107533941 G A -0.01 -0.02 -0.03 0.0 0.01 0.01
vg0107533941 G T -0.03 -0.04 -0.06 -0.05 -0.04 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107533941 NA 7.32E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107533941 NA 1.65E-23 mr1179 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107533941 NA 2.50E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107533941 NA 6.81E-07 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107533941 NA 9.22E-06 mr1246 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107533941 NA 2.34E-12 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107533941 NA 2.09E-08 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107533941 NA 4.00E-21 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107533941 NA 3.67E-09 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107533941 NA 2.96E-08 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107533941 NA 2.32E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107533941 NA 2.31E-14 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107533941 NA 7.99E-07 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107533941 NA 1.27E-12 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107533941 NA 7.35E-14 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107533941 NA 1.46E-06 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107533941 NA 1.90E-08 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107533941 NA 1.05E-08 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107533941 NA 1.16E-06 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107533941 NA 2.00E-06 mr1224_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107533941 NA 7.85E-07 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107533941 NA 6.10E-24 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107533941 NA 4.51E-17 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251