Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107372570:

Variant ID: vg0107372570 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 7372570
Reference Allele: C	Alternative Allele: CT,T
Primary Allele: CT	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATGCACTGGCCAAGCTCTAGGAGTCCATGGCGGATGTGTTGAGCAGCATTTCGCTATTGGCTTCCAAAAGCGACCTCGCCGACCTCAGTCGTTCCGTCG[C/CT,T]
GTGGCCACTTCGCACATCACGGCCCTCGAGCAGTCCTCCACCACCTTGTCCGCGCCTCGCCTGGGCGGCAGCGGCATCTTGCCTGCCGCCACCACCACCA

Reverse complement sequence

TGGTGGTGGTGGCGGCAGGCAAGATGCCGCTGCCGCCCAGGCGAGGCGCGGACAAGGTGGTGGAGGACTGCTCGAGGGCCGTGATGTGCGAAGTGGCCAC[G/AG,A]
CGACGGAACGACTGAGGTCGGCGAGGTCGCTTTTGGAAGCCAATAGCGAAATGCTGCTCAACACATCCGCCATGGACTCCTAGAGCTTGGCCAGTGCATC

Allele Frequencies:

Populations	Population Size	Frequency of CT(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.60%	32.20%	0.36%	0.32%	T: 11.49%
All Indica	2759	91.70%	0.80%	0.47%	0.47%	T: 6.52%
All Japonica	1512	3.30%	91.10%	0.26%	0.00%	T: 5.36%
Aus	269	0.00%	0.70%	0.00%	0.00%	T: 99.26%
Indica I	595	95.60%	1.70%	1.18%	1.01%	T: 0.50%
Indica II	465	89.70%	0.40%	0.22%	0.65%	T: 9.03%
Indica III	913	91.20%	0.40%	0.00%	0.11%	T: 8.21%
Indica Intermediate	786	90.60%	0.80%	0.64%	0.38%	T: 7.63%
Temperate Japonica	767	2.50%	97.50%	0.00%	0.00%	NA
Tropical Japonica	504	5.20%	78.80%	0.40%	0.00%	T: 15.67%
Japonica Intermediate	241	2.10%	96.30%	0.83%	0.00%	T: 0.83%
VI/Aromatic	96	3.10%	89.60%	0.00%	0.00%	T: 7.29%
Intermediate	90	47.80%	41.10%	0.00%	2.22%	T: 8.89%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0107372570	C -> T	LOC_Os01g13229.1	intron_variant ; MODIFIER	silent_mutation	Average:63.705; most accessible tissue: Minghui63 flag leaf, score: 77.153	N	N	N	N
vg0107372570	C -> DEL	N	N	silent_mutation	Average:63.705; most accessible tissue: Minghui63 flag leaf, score: 77.153	N	N	N	N
vg0107372570	C -> CT	LOC_Os01g13229.1	intron_variant ; MODIFIER	silent_mutation	Average:63.705; most accessible tissue: Minghui63 flag leaf, score: 77.153	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0107372570	NA	5.56E-15	mr1166	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107372570	NA	2.52E-07	mr1184	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107372570	NA	5.11E-13	mr1231	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107372570	NA	1.49E-06	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107372570	NA	1.23E-07	mr1320	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107372570	NA	1.59E-07	mr1321	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107372570	1.75E-06	NA	mr1364	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107372570	NA	6.77E-06	mr1373	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107372570	NA	2.93E-07	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107372570	NA	8.01E-07	mr1417	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107372570	NA	6.04E-09	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107372570	6.90E-08	NA	mr1443	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107372570	NA	9.91E-06	mr1512	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107372570	NA	2.46E-20	mr1515	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107372570	NA	1.88E-06	mr1633	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107372570	NA	3.26E-11	mr1649	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107372570	NA	2.51E-07	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107372570	NA	1.77E-07	mr1669	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107372570	NA	1.65E-12	mr1696	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107372570	NA	1.04E-07	mr1706	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107372570	NA	7.60E-06	mr1759	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107372570	NA	8.26E-07	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107372570	NA	3.18E-06	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107372570	NA	3.64E-11	mr1846	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107372570	NA	7.48E-06	mr1906	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107372570	NA	4.25E-09	mr1939	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107372570	NA	7.06E-06	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107372570	NA	1.77E-15	mr1911_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107372570	NA	1.21E-11	mr1918_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107372570	NA	4.05E-06	mr1929_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251