Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107301008:

Variant ID: vg0107301008 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7301008
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, C: 0.07, others allele: 0.00, population size: 43. )

Flanking Sequence (100 bp) in Reference Genome:


AAAATCCAGGCACTTAACAGCAGAAGGACAGGACATGAAGCACATGCAGCGGCCTCAAAAAGGACCACTTCTAGGATAAGTTTTTTTAAGGGTCCATTTA[T/C]
AAAATAAGTTTTTCAGAAGAACCAAAATGTGAAAAATCCAGGCACTTAACAGCAGAAGGACAAGACATGAAGCCCATGCAGCCAAATTGGCCTATCCGGT

Reverse complement sequence

ACCGGATAGGCCAATTTGGCTGCATGGGCTTCATGTCTTGTCCTTCTGCTGTTAAGTGCCTGGATTTTTCACATTTTGGTTCTTCTGAAAAACTTATTTT[A/G]
TAAATGGACCCTTAAAAAAACTTATCCTAGAAGTGGTCCTTTTTGAGGCCGCTGCATGTGCTTCATGTCCTGTCCTTCTGCTGTTAAGTGCCTGGATTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.20% 29.60% 6.71% 15.51% NA
All Indica  2759 23.90% 49.10% 11.05% 15.95% NA
All Japonica  1512 98.30% 1.00% 0.20% 0.53% NA
Aus  269 1.50% 0.00% 0.74% 97.77% NA
Indica I  595 15.60% 54.30% 21.18% 8.91% NA
Indica II  465 2.60% 60.60% 13.76% 23.01% NA
Indica III  913 31.30% 46.00% 6.02% 16.65% NA
Indica Intermediate  786 34.20% 41.90% 7.63% 16.28% NA
Temperate Japonica  767 97.90% 1.40% 0.26% 0.39% NA
Tropical Japonica  504 98.40% 0.40% 0.20% 0.99% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 2.10% 1.04% 8.33% NA
Intermediate  90 48.90% 28.90% 6.67% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107301008 T -> DEL N N silent_mutation Average:84.006; most accessible tissue: Zhenshan97 flower, score: 95.104 N N N N
vg0107301008 T -> C LOC_Os01g13130.1 upstream_gene_variant ; 1360.0bp to feature; MODIFIER silent_mutation Average:84.006; most accessible tissue: Zhenshan97 flower, score: 95.104 N N N N
vg0107301008 T -> C LOC_Os01g13120.1 downstream_gene_variant ; 2037.0bp to feature; MODIFIER silent_mutation Average:84.006; most accessible tissue: Zhenshan97 flower, score: 95.104 N N N N
vg0107301008 T -> C LOC_Os01g13120-LOC_Os01g13130 intergenic_region ; MODIFIER silent_mutation Average:84.006; most accessible tissue: Zhenshan97 flower, score: 95.104 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0107301008 T C -0.01 0.0 0.0 0.0 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107301008 NA 2.04E-11 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107301008 NA 5.29E-16 mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107301008 NA 3.78E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107301008 NA 8.03E-07 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107301008 NA 2.29E-06 mr1212 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107301008 NA 2.12E-21 mr1244 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107301008 NA 3.01E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107301008 NA 2.65E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107301008 NA 1.98E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107301008 2.44E-06 2.44E-06 mr1449 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107301008 NA 1.57E-10 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107301008 NA 6.98E-26 mr1537 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107301008 NA 6.33E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107301008 NA 1.24E-25 mr1244_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107301008 NA 1.08E-16 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107301008 NA 9.99E-08 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251