Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107287429:

Variant ID: vg0107287429 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 7287429
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTTACTATTCTTGAAAAAATACCGAGATGTGCACAATTTGGCCTGTTCGTTTCTTATGAAAGTGGGAGATAAACTTTTGGATTAAAATGGCACGCTTTT[C/T]
AAACGGCTAAACGGCGTGTTTCGTGTGAAAATTTTCTATATGAAAGTTGTTCTAAAATATCAGATTAATCCATTTTTCAAGTTTGTAATAATTAAAACTC

Reverse complement sequence

GAGTTTTAATTATTACAAACTTGAAAAATGGATTAATCTGATATTTTAGAACAACTTTCATATAGAAAATTTTCACACGAAACACGCCGTTTAGCCGTTT[G/A]
AAAAGCGTGCCATTTTAATCCAAAAGTTTATCTCCCACTTTCATAAGAAACGAACAGGCCAAATTGTGCACATCTCGGTATTTTTTCAAGAATAGTAAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.70%	10.30%	0.00%	0.00%	NA
All Indica	2759	93.90%	6.10%	0.00%	0.00%	NA
All Japonica	1512	99.60%	0.40%	0.00%	0.00%	NA
Aus	269	0.70%	99.30%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	90.80%	9.20%	0.00%	0.00%	NA
Indica III	913	92.30%	7.70%	0.00%	0.00%	NA
Indica Intermediate	786	92.90%	7.10%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.00%	1.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	62.50%	37.50%	0.00%	0.00%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0107287429	C -> T	LOC_Os01g13100.1	upstream_gene_variant ; 478.0bp to feature; MODIFIER	silent_mutation	Average:39.748; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0107287429	C -> T	LOC_Os01g13100.2	upstream_gene_variant ; 478.0bp to feature; MODIFIER	silent_mutation	Average:39.748; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0107287429	C -> T	LOC_Os01g13100.3	upstream_gene_variant ; 686.0bp to feature; MODIFIER	silent_mutation	Average:39.748; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0107287429	C -> T	LOC_Os01g13090.1	downstream_gene_variant ; 1437.0bp to feature; MODIFIER	silent_mutation	Average:39.748; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0107287429	C -> T	LOC_Os01g13090.2	downstream_gene_variant ; 1437.0bp to feature; MODIFIER	silent_mutation	Average:39.748; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0107287429	C -> T	LOC_Os01g13090.3	downstream_gene_variant ; 1437.0bp to feature; MODIFIER	silent_mutation	Average:39.748; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0107287429	C -> T	LOC_Os01g13090.4	downstream_gene_variant ; 1437.0bp to feature; MODIFIER	silent_mutation	Average:39.748; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0107287429	C -> T	LOC_Os01g13090-LOC_Os01g13100	intergenic_region ; MODIFIER	silent_mutation	Average:39.748; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0107287429	NA	2.95E-07	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429	NA	3.22E-06	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429	NA	1.01E-20	mr1120	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429	NA	7.35E-07	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429	NA	2.40E-15	mr1166	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429	NA	1.73E-22	mr1210	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429	NA	4.94E-13	mr1231	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429	NA	4.93E-26	mr1305	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429	NA	2.78E-06	mr1320	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429	NA	7.12E-06	mr1373	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429	NA	7.44E-12	mr1409	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429	NA	1.16E-07	mr1415	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429	NA	1.54E-06	mr1417	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429	NA	1.23E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429	NA	4.59E-08	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429	NA	4.06E-19	mr1515	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429	NA	8.84E-12	mr1522	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429	NA	1.16E-07	mr1567	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429	NA	4.66E-07	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429	NA	5.08E-17	mr1765	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429	NA	2.52E-24	mr1868	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429	1.04E-06	NA	mr1928	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429	NA	2.60E-15	mr1911_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429	NA	2.00E-15	mr1961_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251