\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107287429:

Variant ID: vg0107287429 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7287429
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTACTATTCTTGAAAAAATACCGAGATGTGCACAATTTGGCCTGTTCGTTTCTTATGAAAGTGGGAGATAAACTTTTGGATTAAAATGGCACGCTTTT[C/T]
AAACGGCTAAACGGCGTGTTTCGTGTGAAAATTTTCTATATGAAAGTTGTTCTAAAATATCAGATTAATCCATTTTTCAAGTTTGTAATAATTAAAACTC

Reverse complement sequence

GAGTTTTAATTATTACAAACTTGAAAAATGGATTAATCTGATATTTTAGAACAACTTTCATATAGAAAATTTTCACACGAAACACGCCGTTTAGCCGTTT[G/A]
AAAAGCGTGCCATTTTAATCCAAAAGTTTATCTCCCACTTTCATAAGAAACGAACAGGCCAAATTGTGCACATCTCGGTATTTTTTCAAGAATAGTAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.70% 10.30% 0.00% 0.00% NA
All Indica  2759 93.90% 6.10% 0.00% 0.00% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 0.70% 99.30% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 90.80% 9.20% 0.00% 0.00% NA
Indica III  913 92.30% 7.70% 0.00% 0.00% NA
Indica Intermediate  786 92.90% 7.10% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 62.50% 37.50% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107287429 C -> T LOC_Os01g13100.1 upstream_gene_variant ; 478.0bp to feature; MODIFIER silent_mutation Average:39.748; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0107287429 C -> T LOC_Os01g13100.2 upstream_gene_variant ; 478.0bp to feature; MODIFIER silent_mutation Average:39.748; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0107287429 C -> T LOC_Os01g13100.3 upstream_gene_variant ; 686.0bp to feature; MODIFIER silent_mutation Average:39.748; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0107287429 C -> T LOC_Os01g13090.1 downstream_gene_variant ; 1437.0bp to feature; MODIFIER silent_mutation Average:39.748; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0107287429 C -> T LOC_Os01g13090.2 downstream_gene_variant ; 1437.0bp to feature; MODIFIER silent_mutation Average:39.748; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0107287429 C -> T LOC_Os01g13090.3 downstream_gene_variant ; 1437.0bp to feature; MODIFIER silent_mutation Average:39.748; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0107287429 C -> T LOC_Os01g13090.4 downstream_gene_variant ; 1437.0bp to feature; MODIFIER silent_mutation Average:39.748; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0107287429 C -> T LOC_Os01g13090-LOC_Os01g13100 intergenic_region ; MODIFIER silent_mutation Average:39.748; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107287429 NA 2.95E-07 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429 NA 3.22E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429 NA 1.01E-20 mr1120 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429 NA 7.35E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429 NA 2.40E-15 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429 NA 1.73E-22 mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429 NA 4.94E-13 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429 NA 4.93E-26 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429 NA 2.78E-06 mr1320 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429 NA 7.12E-06 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429 NA 7.44E-12 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429 NA 1.16E-07 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429 NA 1.54E-06 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429 NA 1.23E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429 NA 4.59E-08 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429 NA 4.06E-19 mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429 NA 8.84E-12 mr1522 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429 NA 1.16E-07 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429 NA 4.66E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429 NA 5.08E-17 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429 NA 2.52E-24 mr1868 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429 1.04E-06 NA mr1928 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429 NA 2.60E-15 mr1911_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107287429 NA 2.00E-15 mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251