\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107163140:

Variant ID: vg0107163140 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7163140
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTCGCCAACCAGTAATTGCGCCACTGGACCGCTATGCTGAAAGAGCGGTTAACCAGGTCCATGCAAGAAATTTTCCAAGCACAATAGCAACCATGGAA[G/A]
CGAGTAAGTTATGTGATCGGAGAAATGCTGGACAAGTAGTCTTGTATCCTAAAGAATCCATGCCTGCGACGCATCTTCTGAGAATGATGGATCCATCAAC

Reverse complement sequence

GTTGATGGATCCATCATTCTCAGAAGATGCGTCGCAGGCATGGATTCTTTAGGATACAAGACTACTTGTCCAGCATTTCTCCGATCACATAACTTACTCG[C/T]
TTCCATGGTTGCTATTGTGCTTGGAAAATTTCTTGCATGGACCTGGTTAACCGCTCTTTCAGCATAGCGGTCCAGTGGCGCAATTACTGGTTGGCGAGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.40% 47.20% 0.04% 0.40% NA
All Indica  2759 29.60% 69.60% 0.04% 0.69% NA
All Japonica  1512 82.20% 17.80% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 9.20% 90.40% 0.00% 0.34% NA
Indica II  465 11.60% 88.20% 0.00% 0.22% NA
Indica III  913 41.40% 57.70% 0.00% 0.88% NA
Indica Intermediate  786 42.10% 56.70% 0.13% 1.02% NA
Temperate Japonica  767 97.40% 2.60% 0.00% 0.00% NA
Tropical Japonica  504 54.20% 45.80% 0.00% 0.00% NA
Japonica Intermediate  241 92.50% 7.50% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 56.70% 42.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107163140 G -> A LOC_Os01g12890.1 missense_variant ; p.Ala832Thr; MODERATE nonsynonymous_codon ; A832T Average:57.173; most accessible tissue: Zhenshan97 flower, score: 78.5 benign 0.128 TOLERATED 0.25
vg0107163140 G -> DEL LOC_Os01g12890.1 N frameshift_variant Average:57.173; most accessible tissue: Zhenshan97 flower, score: 78.5 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107163140 NA 3.72E-07 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107163140 NA 4.22E-22 mr1244 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107163140 NA 4.21E-10 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107163140 NA 1.80E-08 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107163140 2.64E-06 NA mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107163140 7.63E-07 NA mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107163140 NA 6.35E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107163140 NA 2.91E-08 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107163140 NA 6.47E-08 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107163140 NA 1.26E-07 mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107163140 NA 4.77E-27 mr1244_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107163140 NA 1.84E-16 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107163140 4.65E-10 3.28E-09 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107163140 8.30E-09 1.29E-10 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107163140 4.76E-08 NA mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107163140 NA 2.33E-09 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107163140 1.35E-07 NA mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107163140 5.14E-08 4.26E-09 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107163140 4.07E-06 NA mr1951_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251