\
| Variant ID: vg0107150999 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 7150999 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CATGTCCTCTATTTTGTAAAACCACTCACACTAGACGCACTATTTTTTTTTAACAAGATGTATGTGCTGTGTATAAAAAAATCCTACTAGCTGGCCCACT[A/C]
TTTTGCAAAATGTACTGCAAATACTGATCGAGAACTTCAGTTGTCAAAAGAAGGACCTATACTATGCATGTTTTGCATGATAAGATAAAGCACGAAACGC
GCGTTTCGTGCTTTATCTTATCATGCAAAACATGCATAGTATAGGTCCTTCTTTTGACAACTGAAGTTCTCGATCAGTATTTGCAGTACATTTTGCAAAA[T/G]
AGTGGGCCAGCTAGTAGGATTTTTTTATACACAGCACATACATCTTGTTAAAAAAAAATAGTGCGTCTAGTGTGAGTGGTTTTACAAAATAGAGGACATG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.70% | 16.90% | 0.00% | 0.36% | NA |
| All Indica | 2759 | 71.10% | 28.30% | 0.00% | 0.62% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.80% | 7.90% | 0.00% | 0.34% | NA |
| Indica II | 465 | 65.80% | 34.00% | 0.00% | 0.22% | NA |
| Indica III | 913 | 67.40% | 31.80% | 0.00% | 0.88% | NA |
| Indica Intermediate | 786 | 63.00% | 36.30% | 0.00% | 0.76% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0107150999 | A -> DEL | N | N | silent_mutation | Average:34.969; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg0107150999 | A -> C | LOC_Os01g12880-LOC_Os01g12890 | intergenic_region ; MODIFIER | silent_mutation | Average:34.969; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0107150999 | NA | 5.15E-08 | mr1498 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107150999 | 2.56E-06 | NA | mr1699 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107150999 | 7.37E-06 | 2.57E-07 | mr1699 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107150999 | NA | 2.11E-07 | mr1925 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107150999 | NA | 9.22E-09 | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107150999 | NA | 4.37E-06 | mr1160_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107150999 | NA | 7.65E-06 | mr1160_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107150999 | NA | 2.55E-09 | mr1498_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107150999 | 1.09E-08 | NA | mr1699_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107150999 | 2.10E-07 | 2.54E-12 | mr1699_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107150999 | 3.16E-06 | NA | mr1745_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |