\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107076196:

Variant ID: vg0107076196 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7076196
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTGCTCTTTAGAAGCAAAAGCGGTACAGGTTATTAGAAAAAATAACTTACGAATAAAACTTTTATATACATGTTTATAACGATCAATTAAAAACAAATA[C/T]
AGTAAAATAAACTACGATAAAAAAATCATAAAATCGAAAATAAATTTTTAAATTTAAATTTTGGCTTATAAGAGTTAGAAGAAGCGAAACGATGGAAGCA

Reverse complement sequence

TGCTTCCATCGTTTCGCTTCTTCTAACTCTTATAAGCCAAAATTTAAATTTAAAAATTTATTTTCGATTTTATGATTTTTTTATCGTAGTTTATTTTACT[G/A]
TATTTGTTTTTAATTGATCGTTATAAACATGTATATAAAAGTTTTATTCGTAAGTTATTTTTTCTAATAACCTGTACCGCTTTTGCTTCTAAAGAGCAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.80% 26.90% 0.30% 0.00% NA
All Indica  2759 68.80% 30.70% 0.47% 0.00% NA
All Japonica  1512 74.40% 25.50% 0.07% 0.00% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 87.70% 12.30% 0.00% 0.00% NA
Indica II  465 65.60% 34.40% 0.00% 0.00% NA
Indica III  913 64.10% 35.00% 0.88% 0.00% NA
Indica Intermediate  786 61.80% 37.50% 0.64% 0.00% NA
Temperate Japonica  767 97.90% 2.10% 0.00% 0.00% NA
Tropical Japonica  504 34.30% 65.50% 0.20% 0.00% NA
Japonica Intermediate  241 83.40% 16.60% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107076196 C -> T LOC_Os01g12790.1 upstream_gene_variant ; 3704.0bp to feature; MODIFIER silent_mutation Average:37.462; most accessible tissue: Callus, score: 54.895 N N N N
vg0107076196 C -> T LOC_Os01g12770.1 downstream_gene_variant ; 2407.0bp to feature; MODIFIER silent_mutation Average:37.462; most accessible tissue: Callus, score: 54.895 N N N N
vg0107076196 C -> T LOC_Os01g12780.1 downstream_gene_variant ; 75.0bp to feature; MODIFIER silent_mutation Average:37.462; most accessible tissue: Callus, score: 54.895 N N N N
vg0107076196 C -> T LOC_Os01g12770-LOC_Os01g12780 intergenic_region ; MODIFIER silent_mutation Average:37.462; most accessible tissue: Callus, score: 54.895 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107076196 NA 2.85E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107076196 NA 3.44E-07 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107076196 NA 2.15E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107076196 NA 1.27E-08 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107076196 NA 4.85E-07 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107076196 NA 1.27E-07 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107076196 NA 8.15E-06 mr1699 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107076196 NA 2.26E-24 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107076196 9.18E-07 2.94E-20 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107076196 NA 3.68E-19 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107076196 NA 1.71E-08 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107076196 2.06E-07 1.56E-15 mr1951 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107076196 NA 4.08E-09 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107076196 NA 4.53E-08 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107076196 NA 2.10E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107076196 NA 2.38E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107076196 NA 8.75E-12 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107076196 NA 6.94E-08 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107076196 NA 6.88E-09 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107076196 2.39E-07 8.07E-12 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107076196 NA 1.56E-20 mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107076196 9.10E-06 4.37E-20 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107076196 NA 1.52E-15 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107076196 8.15E-07 NA mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107076196 NA 8.70E-11 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107076196 NA 6.79E-06 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107076196 NA 1.57E-10 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107076196 NA 3.10E-13 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251