\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107062581:

Variant ID: vg0107062581 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7062581
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTTCATACATAACCATATCAATGATAATATTTATATCGGTTGTTATAGCTAAGACATATCATAAGAAAAACGGGAACATCTTCAATGTAATGGTCCAA[T/C]
CTCGACGGTGGTAACCTTATCAATGGCTGCTTTACCCAAAAGAATTGGATTATTTATCTAGTAAAATGCATATAATCTGAAATACTCTTTCAATCTAATT

Reverse complement sequence

AATTAGATTGAAAGAGTATTTCAGATTATATGCATTTTACTAGATAAATAATCCAATTCTTTTGGGTAAAGCAGCCATTGATAAGGTTACCACCGTCGAG[A/G]
TTGGACCATTACATTGAAGATGTTCCCGTTTTTCTTATGATATGTCTTAGCTATAACAACCGATATAAATATTATCATTGATATGGTTATGTATGAAAAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.30% 49.30% 0.23% 0.25% NA
All Indica  2759 41.50% 57.70% 0.36% 0.43% NA
All Japonica  1512 75.80% 24.10% 0.07% 0.00% NA
Aus  269 2.60% 97.40% 0.00% 0.00% NA
Indica I  595 9.90% 89.60% 0.34% 0.17% NA
Indica II  465 58.10% 41.70% 0.00% 0.22% NA
Indica III  913 43.90% 55.20% 0.44% 0.44% NA
Indica Intermediate  786 52.70% 46.10% 0.51% 0.76% NA
Temperate Japonica  767 97.80% 2.10% 0.13% 0.00% NA
Tropical Japonica  504 36.70% 63.30% 0.00% 0.00% NA
Japonica Intermediate  241 87.60% 12.40% 0.00% 0.00% NA
VI/Aromatic  96 24.00% 76.00% 0.00% 0.00% NA
Intermediate  90 61.10% 38.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107062581 T -> DEL N N silent_mutation Average:51.431; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0107062581 T -> C LOC_Os01g12760.1 intron_variant ; MODIFIER silent_mutation Average:51.431; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107062581 NA 3.55E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 1.34E-08 NA mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 2.63E-07 NA mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 2.44E-06 NA mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 NA 2.67E-10 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 NA 1.77E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 7.23E-08 NA mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 6.52E-06 2.24E-11 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 9.41E-06 NA mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 NA 3.09E-22 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 9.19E-09 3.25E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 NA 1.44E-18 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 NA 1.36E-08 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 NA 1.91E-06 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 NA 2.82E-06 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 NA 5.77E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 9.35E-07 NA mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 NA 2.61E-10 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 NA 4.17E-07 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 NA 1.28E-06 mr1236_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 NA 3.83E-08 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 8.37E-15 3.23E-15 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 2.08E-08 1.69E-09 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 2.72E-08 3.12E-11 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 NA 5.30E-12 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 3.69E-10 NA mr1699_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 9.26E-07 9.46E-21 mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 NA 9.73E-10 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 1.70E-13 2.26E-17 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 6.03E-07 NA mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 1.77E-08 1.59E-22 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 NA 8.82E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 5.63E-10 4.03E-10 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 3.12E-07 4.14E-09 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 1.71E-09 4.22E-06 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 2.89E-07 1.46E-08 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107062581 NA 4.50E-06 mr1951_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251