\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107036111:

Variant ID: vg0107036111 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7036111
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCCAAAATAAGTTCTTTTTTAAGTAATCATTATATTGAAGTTAGTAAGAAATAGTTGCATTGAGATTTTATAAAGCAGGGGTATTCTAGTTCTTTATT[G/A]
GTATGTGTGAGATATGTAAAAAATAAACTTATTTTGAAACAGAGAGAATATTTGTTATGGTGAATCTCTAAGAGTTTGGAATCTCATTGTATGGAACTAT

Reverse complement sequence

ATAGTTCCATACAATGAGATTCCAAACTCTTAGAGATTCACCATAACAAATATTCTCTCTGTTTCAAAATAAGTTTATTTTTTACATATCTCACACATAC[C/T]
AATAAAGAACTAGAATACCCCTGCTTTATAAAATCTCAATGCAACTATTTCTTACTAACTTCAATATAATGATTACTTAAAAAAGAACTTATTTTGGAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.80% 26.70% 0.13% 0.34% NA
All Indica  2759 54.00% 45.30% 0.18% 0.58% NA
All Japonica  1512 99.70% 0.20% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 15.60% 84.00% 0.00% 0.34% NA
Indica II  465 83.20% 16.80% 0.00% 0.00% NA
Indica III  913 50.50% 48.40% 0.22% 0.88% NA
Indica Intermediate  786 69.70% 29.10% 0.38% 0.76% NA
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107036111 G -> A LOC_Os01g12720.1 upstream_gene_variant ; 1992.0bp to feature; MODIFIER silent_mutation Average:66.359; most accessible tissue: Minghui63 flower, score: 84.799 N N N N
vg0107036111 G -> A LOC_Os01g12710-LOC_Os01g12720 intergenic_region ; MODIFIER silent_mutation Average:66.359; most accessible tissue: Minghui63 flower, score: 84.799 N N N N
vg0107036111 G -> DEL N N silent_mutation Average:66.359; most accessible tissue: Minghui63 flower, score: 84.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107036111 1.65E-06 4.69E-08 mr1518 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107036111 1.76E-06 4.97E-09 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107036111 NA 7.00E-08 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107036111 NA 6.49E-10 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107036111 NA 4.15E-06 mr1821 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107036111 NA 5.66E-06 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107036111 8.30E-07 1.13E-07 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107036111 NA 3.57E-09 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251