\
| Variant ID: vg0107036111 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 7036111 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 123. )
ATTCCAAAATAAGTTCTTTTTTAAGTAATCATTATATTGAAGTTAGTAAGAAATAGTTGCATTGAGATTTTATAAAGCAGGGGTATTCTAGTTCTTTATT[G/A]
GTATGTGTGAGATATGTAAAAAATAAACTTATTTTGAAACAGAGAGAATATTTGTTATGGTGAATCTCTAAGAGTTTGGAATCTCATTGTATGGAACTAT
ATAGTTCCATACAATGAGATTCCAAACTCTTAGAGATTCACCATAACAAATATTCTCTCTGTTTCAAAATAAGTTTATTTTTTACATATCTCACACATAC[C/T]
AATAAAGAACTAGAATACCCCTGCTTTATAAAATCTCAATGCAACTATTTCTTACTAACTTCAATATAATGATTACTTAAAAAAGAACTTATTTTGGAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.80% | 26.70% | 0.13% | 0.34% | NA |
| All Indica | 2759 | 54.00% | 45.30% | 0.18% | 0.58% | NA |
| All Japonica | 1512 | 99.70% | 0.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 15.60% | 84.00% | 0.00% | 0.34% | NA |
| Indica II | 465 | 83.20% | 16.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 50.50% | 48.40% | 0.22% | 0.88% | NA |
| Indica Intermediate | 786 | 69.70% | 29.10% | 0.38% | 0.76% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0107036111 | G -> A | LOC_Os01g12720.1 | upstream_gene_variant ; 1992.0bp to feature; MODIFIER | silent_mutation | Average:66.359; most accessible tissue: Minghui63 flower, score: 84.799 | N | N | N | N |
| vg0107036111 | G -> A | LOC_Os01g12710-LOC_Os01g12720 | intergenic_region ; MODIFIER | silent_mutation | Average:66.359; most accessible tissue: Minghui63 flower, score: 84.799 | N | N | N | N |
| vg0107036111 | G -> DEL | N | N | silent_mutation | Average:66.359; most accessible tissue: Minghui63 flower, score: 84.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0107036111 | 1.65E-06 | 4.69E-08 | mr1518 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107036111 | 1.76E-06 | 4.97E-09 | mr1676 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107036111 | NA | 7.00E-08 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107036111 | NA | 6.49E-10 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107036111 | NA | 4.15E-06 | mr1821 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107036111 | NA | 5.66E-06 | mr1558_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107036111 | 8.30E-07 | 1.13E-07 | mr1699_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107036111 | NA | 3.57E-09 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |