Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107031364:

Variant ID: vg0107031364 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7031364
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


AACTATAGCTAAAAAAATTTTCTTGGCCAGGTTTCTGGGCACCCCTCTCTCCTACCTAGCTCTGCCCCTAAGTGCATTGCCCGTTCTTCTCTACTAGTCA[A/G]
GTTTTAGGTTGAACTTTTTTTTTAGGGGATAGTTTTAGGTTGAACTGATCTATCCATATATGCCCTTTAATTTTCCATCAGCTTAAGCACTGGGGTTAAA

Reverse complement sequence

TTTAACCCCAGTGCTTAAGCTGATGGAAAATTAAAGGGCATATATGGATAGATCAGTTCAACCTAAAACTATCCCCTAAAAAAAAAGTTCAACCTAAAAC[T/C]
TGACTAGTAGAGAAGAACGGGCAATGCACTTAGGGGCAGAGCTAGGTAGGAGAGAGGGGTGCCCAGAAACCTGGCCAAGAAAATTTTTTTAGCTATAGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.80% 24.80% 0.13% 0.32% NA
All Indica  2759 58.80% 40.50% 0.14% 0.54% NA
All Japonica  1512 99.00% 0.90% 0.13% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 90.80% 8.90% 0.00% 0.34% NA
Indica II  465 42.60% 57.40% 0.00% 0.00% NA
Indica III  913 55.90% 43.20% 0.22% 0.77% NA
Indica Intermediate  786 47.70% 51.30% 0.25% 0.76% NA
Temperate Japonica  767 98.40% 1.40% 0.13% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107031364 A -> G LOC_Os01g12710.1 downstream_gene_variant ; 754.0bp to feature; MODIFIER silent_mutation Average:92.211; most accessible tissue: Minghui63 panicle, score: 96.113 N N N N
vg0107031364 A -> G LOC_Os01g12710.2 downstream_gene_variant ; 754.0bp to feature; MODIFIER silent_mutation Average:92.211; most accessible tissue: Minghui63 panicle, score: 96.113 N N N N
vg0107031364 A -> G LOC_Os01g12710-LOC_Os01g12720 intergenic_region ; MODIFIER silent_mutation Average:92.211; most accessible tissue: Minghui63 panicle, score: 96.113 N N N N
vg0107031364 A -> DEL N N silent_mutation Average:92.211; most accessible tissue: Minghui63 panicle, score: 96.113 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0107031364 A G -0.04 -0.02 0.0 0.04 0.02 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107031364 2.23E-06 NA mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031364 1.23E-07 NA mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031364 NA 3.51E-08 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031364 NA 9.12E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031364 4.53E-10 NA mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031364 2.84E-10 8.89E-10 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031364 9.98E-06 NA mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031364 NA 9.44E-06 mr1705_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031364 NA 1.38E-08 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031364 7.14E-06 NA mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031364 1.60E-07 NA mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031364 NA 7.36E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031364 7.16E-09 NA mr1925_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031364 2.52E-09 5.17E-10 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031364 3.09E-07 6.54E-07 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031364 3.89E-08 8.32E-09 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251