Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106891421:

Variant ID: vg0106891421 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 6891421
Reference Allele: T	Alternative Allele: C,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.03, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

TTATGGTTTCATTGAATGTAATACCAAATCTTTCACTTTTATGCTTACTAAAACTAGTGGAGGGCAAAAGATTTCTTTTACCTTAACATTTTATTATTTG[T/C,A]
GATTGGCCAGTCAGTTGGAAGTGGAAATGAATCTTAGTGGAATGAGTTTCTGATGTTACTTCCCTCTATTGTTCAGGTCAATATGGATGCGATGTTGAGA

Reverse complement sequence

TCTCAACATCGCATCCATATTGACCTGAACAATAGAGGGAAGTAACATCAGAAACTCATTCCACTAAGATTCATTTCCACTTCCAACTGACTGGCCAATC[A/G,T]
CAAATAATAAAATGTTAAGGTAAAAGAAATCTTTTGCCCTCCACTAGTTTTAGTAAGCATAAAAGTGAAAGATTTGGTATTACATTCAATGAAACCATAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.90%	24.10%	0.02%	0.00%	A: 0.04%
All Indica	2759	94.80%	5.20%	0.00%	0.00%	NA
All Japonica	1512	37.10%	62.80%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	95.50%	4.50%	0.00%	0.00%	NA
Indica II	465	97.60%	2.40%	0.00%	0.00%	NA
Indica III	913	96.50%	3.50%	0.00%	0.00%	NA
Indica Intermediate	786	90.60%	9.40%	0.00%	0.00%	NA
Temperate Japonica	767	13.30%	86.70%	0.00%	0.00%	NA
Tropical Japonica	504	66.90%	33.10%	0.00%	0.00%	NA
Japonica Intermediate	241	50.60%	49.00%	0.41%	0.00%	NA
VI/Aromatic	96	76.00%	24.00%	0.00%	0.00%	NA
Intermediate	90	75.60%	22.20%	0.00%	0.00%	A: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0106891421	T -> A	LOC_Os01g12530.5	5_prime_UTR_variant ; 1288.0bp to feature; MODIFIER	silent_mutation	Average:36.256; most accessible tissue: Minghui63 flag leaf, score: 55.781	N	N	N	N
vg0106891421	T -> A	LOC_Os01g12530.6	upstream_gene_variant ; 1226.0bp to feature; MODIFIER	silent_mutation	Average:36.256; most accessible tissue: Minghui63 flag leaf, score: 55.781	N	N	N	N
vg0106891421	T -> A	LOC_Os01g12530.1	intron_variant ; MODIFIER	silent_mutation	Average:36.256; most accessible tissue: Minghui63 flag leaf, score: 55.781	N	N	N	N
vg0106891421	T -> A	LOC_Os01g12530.4	intron_variant ; MODIFIER	silent_mutation	Average:36.256; most accessible tissue: Minghui63 flag leaf, score: 55.781	N	N	N	N
vg0106891421	T -> A	LOC_Os01g12530.2	intron_variant ; MODIFIER	silent_mutation	Average:36.256; most accessible tissue: Minghui63 flag leaf, score: 55.781	N	N	N	N
vg0106891421	T -> A	LOC_Os01g12530.3	intron_variant ; MODIFIER	silent_mutation	Average:36.256; most accessible tissue: Minghui63 flag leaf, score: 55.781	N	N	N	N
vg0106891421	T -> C	LOC_Os01g12530.5	5_prime_UTR_variant ; 1288.0bp to feature; MODIFIER	silent_mutation	Average:36.256; most accessible tissue: Minghui63 flag leaf, score: 55.781	N	N	N	N
vg0106891421	T -> C	LOC_Os01g12530.6	upstream_gene_variant ; 1226.0bp to feature; MODIFIER	silent_mutation	Average:36.256; most accessible tissue: Minghui63 flag leaf, score: 55.781	N	N	N	N
vg0106891421	T -> C	LOC_Os01g12530.1	intron_variant ; MODIFIER	silent_mutation	Average:36.256; most accessible tissue: Minghui63 flag leaf, score: 55.781	N	N	N	N
vg0106891421	T -> C	LOC_Os01g12530.4	intron_variant ; MODIFIER	silent_mutation	Average:36.256; most accessible tissue: Minghui63 flag leaf, score: 55.781	N	N	N	N
vg0106891421	T -> C	LOC_Os01g12530.2	intron_variant ; MODIFIER	silent_mutation	Average:36.256; most accessible tissue: Minghui63 flag leaf, score: 55.781	N	N	N	N
vg0106891421	T -> C	LOC_Os01g12530.3	intron_variant ; MODIFIER	silent_mutation	Average:36.256; most accessible tissue: Minghui63 flag leaf, score: 55.781	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0106891421	NA	2.21E-08	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421	NA	8.52E-08	mr1364	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421	NA	9.06E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421	NA	7.37E-07	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421	NA	1.11E-07	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421	NA	2.48E-41	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421	NA	6.85E-14	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421	NA	2.07E-08	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421	NA	4.74E-18	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421	NA	1.63E-07	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421	NA	6.06E-37	mr1980	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421	NA	2.76E-09	mr1980	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421	NA	3.78E-06	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421	NA	1.23E-09	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421	1.49E-07	1.52E-10	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421	NA	5.68E-39	mr1533_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421	NA	6.80E-08	mr1659_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421	NA	6.21E-08	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421	2.45E-10	2.16E-10	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421	2.18E-12	4.09E-27	mr1769_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421	NA	2.23E-06	mr1951_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421	NA	8.08E-18	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251