\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106891421:

Variant ID: vg0106891421 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6891421
Reference Allele: TAlternative Allele: C,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.03, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


TTATGGTTTCATTGAATGTAATACCAAATCTTTCACTTTTATGCTTACTAAAACTAGTGGAGGGCAAAAGATTTCTTTTACCTTAACATTTTATTATTTG[T/C,A]
GATTGGCCAGTCAGTTGGAAGTGGAAATGAATCTTAGTGGAATGAGTTTCTGATGTTACTTCCCTCTATTGTTCAGGTCAATATGGATGCGATGTTGAGA

Reverse complement sequence

TCTCAACATCGCATCCATATTGACCTGAACAATAGAGGGAAGTAACATCAGAAACTCATTCCACTAAGATTCATTTCCACTTCCAACTGACTGGCCAATC[A/G,T]
CAAATAATAAAATGTTAAGGTAAAAGAAATCTTTTGCCCTCCACTAGTTTTAGTAAGCATAAAAGTGAAAGATTTGGTATTACATTCAATGAAACCATAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.90% 24.10% 0.02% 0.00% A: 0.04%
All Indica  2759 94.80% 5.20% 0.00% 0.00% NA
All Japonica  1512 37.10% 62.80% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.50% 4.50% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 96.50% 3.50% 0.00% 0.00% NA
Indica Intermediate  786 90.60% 9.40% 0.00% 0.00% NA
Temperate Japonica  767 13.30% 86.70% 0.00% 0.00% NA
Tropical Japonica  504 66.90% 33.10% 0.00% 0.00% NA
Japonica Intermediate  241 50.60% 49.00% 0.41% 0.00% NA
VI/Aromatic  96 76.00% 24.00% 0.00% 0.00% NA
Intermediate  90 75.60% 22.20% 0.00% 0.00% A: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106891421 T -> A LOC_Os01g12530.5 5_prime_UTR_variant ; 1288.0bp to feature; MODIFIER silent_mutation Average:36.256; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg0106891421 T -> A LOC_Os01g12530.6 upstream_gene_variant ; 1226.0bp to feature; MODIFIER silent_mutation Average:36.256; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg0106891421 T -> A LOC_Os01g12530.1 intron_variant ; MODIFIER silent_mutation Average:36.256; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg0106891421 T -> A LOC_Os01g12530.4 intron_variant ; MODIFIER silent_mutation Average:36.256; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg0106891421 T -> A LOC_Os01g12530.2 intron_variant ; MODIFIER silent_mutation Average:36.256; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg0106891421 T -> A LOC_Os01g12530.3 intron_variant ; MODIFIER silent_mutation Average:36.256; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg0106891421 T -> C LOC_Os01g12530.5 5_prime_UTR_variant ; 1288.0bp to feature; MODIFIER silent_mutation Average:36.256; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg0106891421 T -> C LOC_Os01g12530.6 upstream_gene_variant ; 1226.0bp to feature; MODIFIER silent_mutation Average:36.256; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg0106891421 T -> C LOC_Os01g12530.1 intron_variant ; MODIFIER silent_mutation Average:36.256; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg0106891421 T -> C LOC_Os01g12530.4 intron_variant ; MODIFIER silent_mutation Average:36.256; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg0106891421 T -> C LOC_Os01g12530.2 intron_variant ; MODIFIER silent_mutation Average:36.256; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg0106891421 T -> C LOC_Os01g12530.3 intron_variant ; MODIFIER silent_mutation Average:36.256; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106891421 NA 2.21E-08 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421 NA 8.52E-08 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421 NA 9.06E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421 NA 7.37E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421 NA 1.11E-07 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421 NA 2.48E-41 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421 NA 6.85E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421 NA 2.07E-08 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421 NA 4.74E-18 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421 NA 1.63E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421 NA 6.06E-37 mr1980 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421 NA 2.76E-09 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421 NA 3.78E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421 NA 1.23E-09 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421 1.49E-07 1.52E-10 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421 NA 5.68E-39 mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421 NA 6.80E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421 NA 6.21E-08 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421 2.45E-10 2.16E-10 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421 2.18E-12 4.09E-27 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421 NA 2.23E-06 mr1951_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106891421 NA 8.08E-18 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251