Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0106873407:

Variant ID: vg0106873407 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6873407
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCATGCAGGGGCTCTCTCTACTCTAGTGGCCGGCCGGCTTGCAGCCACCGCGCGCGCGCGAGCGCCGGGGCCGTGGTAACGTAGCCGCCGCGCGCATTGG[T/C]
CCCGTGTGACCCACACGCCCACACATGTCGGCCCGTTCGGTGTGCCCTGCCCGTGCGCCAACGCACAGGTTTGGTTTGGTTGGATGTTGATGTGGATTGC

Reverse complement sequence

GCAATCCACATCAACATCCAACCAAACCAAACCTGTGCGTTGGCGCACGGGCAGGGCACACCGAACGGGCCGACATGTGTGGGCGTGTGGGTCACACGGG[A/G]
CCAATGCGCGCGGCGGCTACGTTACCACGGCCCCGGCGCTCGCGCGCGCGCGGTGGCTGCAAGCCGGCCGGCCACTAGAGTAGAGAGAGCCCCTGCATGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.30% 48.60% 0.13% 0.04% NA
All Indica  2759 84.40% 15.50% 0.07% 0.04% NA
All Japonica  1512 2.90% 96.90% 0.13% 0.07% NA
Aus  269 0.70% 99.30% 0.00% 0.00% NA
Indica I  595 93.90% 6.10% 0.00% 0.00% NA
Indica II  465 73.50% 26.20% 0.22% 0.00% NA
Indica III  913 89.30% 10.60% 0.00% 0.11% NA
Indica Intermediate  786 78.00% 21.90% 0.13% 0.00% NA
Temperate Japonica  767 1.70% 98.20% 0.13% 0.00% NA
Tropical Japonica  504 5.20% 94.80% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.10% 0.41% 0.41% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 48.90% 48.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106873407 T -> DEL N N silent_mutation Average:92.216; most accessible tissue: Zhenshan97 flower, score: 98.313 N N N N
vg0106873407 T -> C LOC_Os01g12510.1 downstream_gene_variant ; 2481.0bp to feature; MODIFIER silent_mutation Average:92.216; most accessible tissue: Zhenshan97 flower, score: 98.313 N N N N
vg0106873407 T -> C LOC_Os01g12500-LOC_Os01g12510 intergenic_region ; MODIFIER silent_mutation Average:92.216; most accessible tissue: Zhenshan97 flower, score: 98.313 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0106873407 T C 0.27 0.24 0.2 0.09 0.06 0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106873407 NA 1.04E-08 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106873407 1.37E-11 2.74E-07 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106873407 8.51E-14 7.51E-26 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106873407 NA 1.71E-19 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106873407 2.53E-09 NA mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106873407 1.07E-10 7.04E-23 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106873407 NA 3.43E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106873407 1.15E-08 2.00E-23 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106873407 9.50E-07 9.50E-07 mr1916 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106873407 6.24E-08 NA mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106873407 2.32E-09 1.31E-13 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106873407 NA 2.16E-21 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106873407 3.66E-13 NA mr1951 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106873407 1.27E-16 1.32E-20 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106873407 1.51E-08 2.54E-14 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106873407 NA 4.10E-19 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106873407 6.11E-13 NA mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106873407 2.00E-13 1.05E-25 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106873407 8.15E-10 NA mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106873407 2.79E-13 4.90E-32 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106873407 2.37E-07 1.89E-29 mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106873407 5.83E-08 6.82E-10 mr1916_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106873407 1.38E-07 NA mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106873407 3.77E-08 2.31E-13 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106873407 NA 8.54E-29 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106873407 4.34E-06 NA mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106873407 7.87E-09 3.10E-16 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251